ID: 950590741

View in Genome Browser
Species Human (GRCh38)
Location 3:13934484-13934506
Sequence CCCAAGGACGGGGGCAGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 1, 2: 0, 3: 17, 4: 192}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950590733_950590741 -5 Left 950590733 3:13934466-13934488 CCGCTGAGGGAGGACGAACCCAA 0: 1
1: 1
2: 0
3: 5
4: 88
Right 950590741 3:13934484-13934506 CCCAAGGACGGGGGCAGTGTGGG 0: 1
1: 1
2: 0
3: 17
4: 192
950590731_950590741 5 Left 950590731 3:13934456-13934478 CCTCAGGGCTCCGCTGAGGGAGG 0: 1
1: 1
2: 2
3: 22
4: 333
Right 950590741 3:13934484-13934506 CCCAAGGACGGGGGCAGTGTGGG 0: 1
1: 1
2: 0
3: 17
4: 192
950590726_950590741 24 Left 950590726 3:13934437-13934459 CCGACGAGGATTACATCGTCCTC 0: 1
1: 0
2: 1
3: 0
4: 29
Right 950590741 3:13934484-13934506 CCCAAGGACGGGGGCAGTGTGGG 0: 1
1: 1
2: 0
3: 17
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950590741 Original CRISPR CCCAAGGACGGGGGCAGTGT GGG Intergenic
900032664 1:382131-382153 CCACAGGACGGGGGCAGAGTCGG - Intergenic
900053422 1:611193-611215 CCACAGGACGGGGGCAGAGTCGG - Intergenic
900796858 1:4713153-4713175 CCCATGGACGGGGGCATGGACGG + Intronic
900806787 1:4772759-4772781 CCCCTGGACGTGGGCAGTGGCGG + Intronic
901451042 1:9337318-9337340 GCCAAGGACGGGGGCTCAGTGGG + Intronic
902650928 1:17837100-17837122 CCCAAGGATGGGGACAGTGGGGG + Intergenic
902755827 1:18548573-18548595 CCCAATGACTGGGGCAGTATGGG - Intergenic
903846005 1:26280285-26280307 CCCCAGGACGGGGGCGGGGTGGG + Intronic
904221316 1:28972035-28972057 CCCAGCTACGGGGGCAGGGTAGG - Intronic
904237852 1:29125496-29125518 CCCAAGCACGGGGTCAGCCTTGG + Intergenic
904823251 1:33258296-33258318 CCAAGGCACTGGGGCAGTGTTGG + Intronic
904912158 1:33943249-33943271 CACAAGGATGGGGGCAGCCTAGG - Intronic
905814305 1:40936825-40936847 CCCAAGGAGGGGGGAAGTATTGG + Intergenic
907460255 1:54601520-54601542 CCCCAGCACGGGGGTAGGGTGGG - Intronic
909924915 1:81427513-81427535 CCCATGTAAGGGGGCAGTTTTGG + Intronic
913147034 1:116002622-116002644 CCACAGGCCTGGGGCAGTGTTGG - Intronic
914239775 1:145845848-145845870 CCCCAGAGCGGGGGCAGTGAAGG + Intronic
916081193 1:161233435-161233457 ACGAAGGATGGGGGCAGTGGGGG + Intronic
916676159 1:167065871-167065893 CCCTGGGACTGGAGCAGTGTGGG + Intronic
917969536 1:180197978-180198000 CCCAAGGCAGGGGGTAGCGTGGG - Exonic
920101931 1:203522166-203522188 CCCCAGGACAGGTGCAGAGTGGG - Intergenic
923025712 1:230202364-230202386 CCCTAGGGCAGAGGCAGTGTTGG - Intronic
923500677 1:234561143-234561165 CCCAAGCACAGGGCCTGTGTGGG - Intergenic
923660068 1:235950171-235950193 CCCAGGGGTGGTGGCAGTGTTGG - Intergenic
1062809650 10:452942-452964 TGCGAGGAAGGGGGCAGTGTTGG + Intronic
1062958878 10:1558217-1558239 CCCATGGAGGGGGGCAGAGGTGG - Intronic
1062958925 10:1558395-1558417 CCCACGGAGGGGGGCAGAGGTGG - Intronic
1062958944 10:1558454-1558476 CCCACGGAGGGGGGCAGAGGTGG - Intronic
1062958989 10:1558631-1558653 CCCACGGAGGGGGGCAGAGGTGG - Intronic
1063408814 10:5820774-5820796 CCGAAGGATGGGGGCAGGGGTGG - Intronic
1065778245 10:29142709-29142731 GCCCAGGACGGGGGCATGGTGGG - Intergenic
1067494321 10:46748269-46748291 CCCAAGGAAGGGGTGAGTGAAGG - Intergenic
1067600338 10:47592128-47592150 CCCAAGGAAGGGGTGAGTGAAGG + Intergenic
1068237780 10:54262016-54262038 CCCAAGGAAGGGGTGAGTGAAGG + Intronic
1069709034 10:70477743-70477765 CCCCAGGATGCAGGCAGTGTAGG - Intergenic
1069750366 10:70741463-70741485 GCCAAGGCCGGCAGCAGTGTTGG + Intronic
1072041603 10:91611698-91611720 ACCCAGGACAGGGGCAGGGTTGG + Intergenic
1072614399 10:97039929-97039951 CCACAGGACGGGGACAGTGGGGG - Intronic
1072709306 10:97705711-97705733 CCCAAGGGCTGGGCTAGTGTTGG - Intergenic
1072717054 10:97759317-97759339 CCCAAGGACGGGTGCCTGGTTGG - Exonic
1073192516 10:101661793-101661815 CCCAGGGTCAGGGGCAGAGTGGG - Intronic
1075486653 10:122827960-122827982 CCCATGGAGGAGGGCAGTTTTGG + Intergenic
1075671195 10:124265155-124265177 CCCAAGAACTGAGGAAGTGTGGG + Intergenic
1077111516 11:864166-864188 CCCAGGGATGGGGGCAGGGGAGG + Intronic
1077168147 11:1152930-1152952 CCCCAGGGCGGGGACAGTGCCGG - Intergenic
1077892774 11:6431454-6431476 CCCCAGGACGGCGGCTGTGGTGG - Exonic
1078932680 11:15924844-15924866 GCCATGGACAGGGGCAGTGTAGG - Intergenic
1079094501 11:17501883-17501905 CCCCAGGAACAGGGCAGTGTGGG - Intronic
1083991141 11:66246459-66246481 CCCGAGGATGGGAGCAGGGTGGG - Intergenic
1084419526 11:69053349-69053371 CCCATGGACCGGGACAGTGAGGG + Intronic
1085031339 11:73272668-73272690 CCGCAGGACGGGGTCAGTGGGGG + Intronic
1085772495 11:79337829-79337851 GCCAAGGACAGGGGCAAAGTGGG + Intronic
1089869115 11:121656744-121656766 TCCCAGGAAGGGGGCAGTGGAGG + Intergenic
1090365195 11:126199684-126199706 CCCAACTACGGCAGCAGTGTGGG + Intergenic
1091198614 11:133753174-133753196 CCCAAGGAATGGGGAAGGGTCGG + Intergenic
1091227860 11:133968457-133968479 CCCCAGGCTGGGGGCAGTGGTGG + Intergenic
1091590204 12:1838263-1838285 CCCAGCCACGGGGGCAGTGGCGG - Intronic
1092016584 12:5164090-5164112 CCCAAGACTGGGGGCAGTGGGGG - Intergenic
1094650427 12:32370520-32370542 CCCAAGGCCTGGGTCAGTGCTGG + Intronic
1096365536 12:51026079-51026101 CCCAAAGATGGGGGCAGGGAGGG - Intronic
1101065550 12:101016694-101016716 CCCAAGGAAGTGGGCCATGTGGG + Intronic
1102201357 12:111059885-111059907 CCCAAGGTCGGGGGCAGGGAAGG - Intronic
1103122145 12:118389239-118389261 CCCACGGGCTGGGGCAGGGTAGG - Intronic
1103200878 12:119086976-119086998 CCCAAGGTGGGAGGCAGTGCTGG + Intronic
1103626944 12:122226753-122226775 CCGAAGAACGAGGGCAGTTTGGG - Intronic
1103902043 12:124308451-124308473 TCCAAGGACAAGGGCAGTGTGGG - Intronic
1103967077 12:124646714-124646736 CCCGAGCGCGGGGGCAGGGTGGG + Intergenic
1104483456 12:129128746-129128768 CCCAAGGGTGGGGGCAGGATGGG - Intronic
1104538520 12:129641137-129641159 TCCATGGACCGGGGCAGGGTGGG - Intronic
1104980278 12:132570477-132570499 GCCGGGGGCGGGGGCAGTGTCGG - Exonic
1107335368 13:39348806-39348828 CCCTAGGAAGAGGGTAGTGTGGG - Intronic
1109683906 13:65788014-65788036 CCCATGAAAGGGGGCAGTTTTGG - Intergenic
1112594440 13:100795108-100795130 TCCATGGATGGGGCCAGTGTGGG - Intergenic
1113200755 13:107866190-107866212 CCCGGGGAGGGGGGCAGGGTGGG + Exonic
1119123107 14:72098166-72098188 CCCGAGGATGGGGGCGGTTTTGG - Intronic
1120246264 14:82010910-82010932 CCCAAGGAAGGGGTAAGTGAAGG + Intergenic
1122979492 14:105185234-105185256 CGCGAGGACGGAGGCAGAGTCGG - Intergenic
1124235251 15:27984427-27984449 CCCAAGGCCGGGTCCTGTGTGGG - Intronic
1128678691 15:69630406-69630428 GCCAAGGACGGAGGCTGAGTTGG - Intergenic
1129606744 15:77028683-77028705 CCCAGGGCTGGGGGCAGTGGGGG + Intronic
1132087226 15:98918293-98918315 CTCAGGGTCGGGGGCAGTGAGGG - Intronic
1132786251 16:1658416-1658438 CCCAGGGAAGGGGCCAGGGTGGG + Intronic
1133318893 16:4900959-4900981 GCCAAGGACGGGGACAAGGTGGG - Exonic
1135470967 16:22730259-22730281 TCCATGGACTGGGGCAGGGTTGG - Intergenic
1136502271 16:30677905-30677927 CCCAAGGTGGTGGGCAGTGATGG + Intergenic
1139263310 16:65616479-65616501 CCCAAGGACTGGAGCAGTTCAGG + Intergenic
1139892440 16:70262257-70262279 CCCAAGGCCTGGAGCACTGTGGG + Intronic
1141658571 16:85429425-85429447 ACCAAGGACGGGGGCTCTGGTGG + Intergenic
1142192690 16:88725191-88725213 CACAGTGACGGGGGCCGTGTGGG + Intronic
1143628772 17:8125460-8125482 CCCAAGGAGGGGGGCGGCGGGGG - Intergenic
1144770697 17:17757851-17757873 CCCATGGAACAGGGCAGTGTTGG + Intronic
1146124903 17:30223850-30223872 CCGAAGGAAGGGGGAAGTGGGGG - Intronic
1147767942 17:42849412-42849434 TCCAAGGACTGGGGCAGGGGAGG - Intronic
1148738794 17:49880437-49880459 CCCCAGGACGGGGGCAGGATGGG - Intergenic
1151999961 17:77639058-77639080 ACCAAGGTCGGGGGCAGAGCCGG + Intergenic
1152947276 17:83205054-83205076 CCACAGGACGGGGGCAGAGTCGG + Intergenic
1153229406 18:2921967-2921989 CCCAAGGTGGGGGGATGTGTGGG - Intronic
1157112801 18:44836733-44836755 ACCGAGGACTGGGGCAGTATGGG + Intronic
1157158363 18:45289279-45289301 CCCAAGGTGGGAGGCAGTGAGGG + Intronic
1159414042 18:68120593-68120615 GGCAGTGACGGGGGCAGTGTGGG + Intergenic
1159887388 18:73922335-73922357 CCCAAGGCTGGGAGCTGTGTTGG - Intergenic
1160209231 18:76862396-76862418 CCAAGGGACGGGGGCAGAATGGG - Intronic
1160454970 18:78993549-78993571 CCCACGGACGTGGGCACGGTGGG - Exonic
1160895642 19:1400769-1400791 CCCCTGGACGGGGCCTGTGTGGG + Intronic
1161563316 19:4985741-4985763 CCCAACGCTGGGGGCAGTGAAGG - Intronic
1162140125 19:8580563-8580585 TCAAAGGAGGGGGGGAGTGTTGG + Exonic
1163540213 19:17904368-17904390 CCTAAGGCCTGGGGCAGAGTAGG + Intergenic
1164747964 19:30629824-30629846 GCCAAGGGCAGGGGCAGTGAGGG + Intronic
1165166215 19:33859021-33859043 CCCATAAAAGGGGGCAGTGTTGG + Intergenic
1166216018 19:41335629-41335651 CCCAAGGCCCGGTGCAGGGTAGG - Intronic
1166317266 19:41996240-41996262 CCCTAGGAAGAGGGCAGAGTTGG - Intronic
1166809995 19:45508878-45508900 CCTGAGGGCGGGGCCAGTGTGGG + Intronic
1202652186 1_KI270707v1_random:16507-16529 TGTAAGGACAGGGGCAGTGTTGG - Intergenic
1202659951 1_KI270708v1_random:59223-59245 TGTAAGGACAGGGGCAGTGTTGG + Intergenic
925910728 2:8571959-8571981 CCCCAGCACGGGGACACTGTGGG + Intergenic
928800942 2:35090863-35090885 ACCAAGAACGGGGGTGGTGTGGG + Intergenic
930754408 2:54960365-54960387 GCCAGGGAAGGGGGAAGTGTAGG + Intronic
932781244 2:74560042-74560064 CCCTTGGATGGGGGCGGTGTTGG + Intronic
937098958 2:119254096-119254118 GCCAGTGATGGGGGCAGTGTGGG + Intronic
937859053 2:126694022-126694044 CCTAAGGACTTGGGCAGTGGTGG + Intronic
938079973 2:128364733-128364755 GCCATGGGTGGGGGCAGTGTGGG - Intergenic
941129249 2:161625854-161625876 ACAGAGGACAGGGGCAGTGTCGG + Intronic
941846567 2:170140238-170140260 GCCAAAGACGTGGGCAGTGCTGG + Intergenic
942561062 2:177219108-177219130 CCCATGAAAGGGGGCAGTTTTGG + Exonic
943302780 2:186224009-186224031 CCAAAGGCCTGGGGCAGTGGTGG + Intergenic
1171096463 20:22336794-22336816 CCCAAAGATAGGGGCAGTGATGG - Intergenic
1175203951 20:57296940-57296962 TCGATGGACGGGGGCAGGGTGGG + Intergenic
1176188227 20:63793177-63793199 CTCAAGCCCGGGGCCAGTGTGGG - Intronic
1176628075 21:9111804-9111826 TGTAAGGACAGGGGCAGTGTCGG - Intergenic
1176645910 21:9349404-9349426 TGTAAGGACAGGGGCAGTGTTGG + Intergenic
1180327425 22:11442785-11442807 TGTAAGGACAGGGGCAGTGTTGG + Intergenic
1180367016 22:11949749-11949771 TGTAAGGACAGGGGCAGTGTTGG - Intergenic
1180418456 22:12791714-12791736 TGTAAGGACAGGGGCAGTGTTGG - Intergenic
1182620325 22:31615144-31615166 CCCCAGGCAGGGGGCTGTGTGGG - Exonic
1185246000 22:49773215-49773237 CCCAAGGACGGGTGGGGTGCTGG - Intergenic
950590741 3:13934484-13934506 CCCAAGGACGGGGGCAGTGTGGG + Intergenic
950711931 3:14819303-14819325 CCCAAGGACGAGGGCAGTGTGGG + Exonic
953667991 3:44939914-44939936 CCCAAGGAGAAGGGTAGTGTGGG - Intronic
953749978 3:45601507-45601529 CCCCAGGAAGGGGGCACTGTGGG - Intronic
954672868 3:52299856-52299878 CCCAGGGAGGAGGGCAGGGTAGG + Intergenic
954800561 3:53184809-53184831 CCAAGGGCAGGGGGCAGTGTAGG - Intronic
956049676 3:65234444-65234466 CCCAAGGTAGGGGGCTGTGGGGG + Intergenic
957028762 3:75215528-75215550 CCCATGAAAGGGGGCAGTTTTGG + Intergenic
959109636 3:102106519-102106541 ACCAGGGGCTGGGGCAGTGTTGG - Intronic
961463001 3:127064764-127064786 CCTCAGGACGGGGGCAGGGGTGG + Intergenic
963107295 3:141658308-141658330 CCCGAGGACAGGGACAGTGAGGG - Intergenic
1202740975 3_GL000221v1_random:55659-55681 TGTAAGGACAGGGGCAGTGTTGG - Intergenic
968517695 4:1021759-1021781 CCCAAGGACAAGGGCAGTAGGGG - Intronic
970378188 4:15479750-15479772 CCCAAGGCCAGGGGCTGTGGAGG + Intronic
972770998 4:42196884-42196906 CCCCAAGACGGGGGCAGGGGCGG - Intergenic
973363330 4:49185565-49185587 TGTAAGGACAGGGGCAGTGTTGG + Intergenic
973397765 4:49611291-49611313 TGTAAGGACAGGGGCAGTGTTGG - Intergenic
973567744 4:52205335-52205357 CCCAAAGGTGGGGGCAGGGTGGG + Intergenic
976943708 4:90738744-90738766 CCCTAGGCCTGGGGTAGTGTTGG - Intronic
979046656 4:115874159-115874181 CCCAAGGAAGGGGTAAGTGAAGG - Intergenic
982095568 4:151918887-151918909 GCCAAGGGCTGTGGCAGTGTGGG + Intergenic
983336384 4:166398799-166398821 CCAAAGGACGATGGCAGTGAGGG + Intergenic
984654190 4:182299765-182299787 GCCAAGGACGGGGGGAGGGAGGG + Intronic
986236112 5:5912250-5912272 CCCAGGGAGGAGGGGAGTGTGGG + Intergenic
986260712 5:6143662-6143684 CCTCAGGCCGGGGGCAGTGAGGG - Intergenic
986574915 5:9202040-9202062 CCCCAGGACGGGAGCAGTTCAGG + Exonic
987181349 5:15371928-15371950 CCCAATGCCTGGGGCAGTGCCGG - Intergenic
989650013 5:43677460-43677482 CCCAAGGGTGTGTGCAGTGTCGG + Intronic
995844169 5:116476147-116476169 CCCAAGGACTGGGGCAGGGCTGG - Intronic
996747103 5:126854780-126854802 CCCCAGCCCGGGGGCAGTGAGGG - Intergenic
997856390 5:137376527-137376549 CCCAGGGATGGGGGCAGAGGGGG + Intronic
1002741156 5:181436737-181436759 CCACAGGACGGGGGCAGAGTCGG + Intergenic
1003178542 6:3771957-3771979 CCCAAGGGCTGAGGGAGTGTGGG + Intergenic
1003377717 6:5594771-5594793 TCCAAGGACAGGGGCTGTGCTGG + Intronic
1004110351 6:12712192-12712214 CACAGGGAGGGAGGCAGTGTGGG - Intergenic
1005794811 6:29348220-29348242 GCCAAGGATGGGGGCATGGTGGG + Intergenic
1007092217 6:39191365-39191387 ACCAGGGAAGGGGGCAGTGCTGG + Exonic
1007585502 6:42986578-42986600 CCCAAGGACAGGGCCTGGGTGGG - Intronic
1011940608 6:92837550-92837572 ACCATGGACGGGGGCAAAGTGGG - Intergenic
1013235902 6:108197751-108197773 CACAGGGAAGGGGGCAGTGAGGG + Intergenic
1015025993 6:128533117-128533139 CCCAATGCCCAGGGCAGTGTTGG - Intergenic
1019246270 6:170712434-170712456 CCACAGGACGGGGGCAGAGTCGG + Intergenic
1020137864 7:5596543-5596565 CCCAGGGTCGGGGCCAGGGTAGG - Intronic
1024564780 7:50672342-50672364 CCCTCGGAGGGAGGCAGTGTGGG - Intronic
1027218997 7:76202162-76202184 CCCGAGCAGAGGGGCAGTGTGGG + Intronic
1029488149 7:100855729-100855751 CCCGAGGTCGGGGGCAGCATTGG + Exonic
1034271514 7:149805502-149805524 CCCCAGGGCTGGGGCAGAGTCGG - Intergenic
1035501802 8:95255-95277 CCACAGGACGGGGGCAGAGTCGG - Intergenic
1035577618 8:717873-717895 CCCAGGGACGGGGGCAGGCCAGG + Intronic
1036773439 8:11594008-11594030 CTCCAGGACGAGGGCAGTGGGGG + Intergenic
1039129956 8:34251901-34251923 CCCAAGGAGGGTTGCAATGTGGG + Intergenic
1041636639 8:60153054-60153076 CCCAAGGGGGGGGACAGGGTGGG + Intergenic
1046614743 8:116463681-116463703 CCCCAGGAAGGGAGAAGTGTAGG - Intergenic
1047162153 8:122392555-122392577 CCCAAGGACAGGGCCAGGGATGG + Intergenic
1048385054 8:133904377-133904399 CCCAGGGAGGGAGTCAGTGTGGG + Intergenic
1049437920 8:142596176-142596198 CTCCAGGACGGGGGCTGTCTAGG + Intergenic
1050325959 9:4497271-4497293 CCCAAGGTCGAGGGCAGAGCCGG + Intronic
1051666456 9:19471174-19471196 CCCAAGAACAGGAGCTGTGTGGG - Intergenic
1052291812 9:26850308-26850330 CACAAGTACGTGGGCAGAGTGGG + Intronic
1055427187 9:76208234-76208256 CCCAAGGACTGAGGCACAGTGGG + Intronic
1055596195 9:77867167-77867189 CCCAAGGCGGGGGGAAGTGGGGG - Intronic
1057963337 9:99478297-99478319 GCCAAGGCTGGGGCCAGTGTAGG - Intergenic
1061086856 9:128404666-128404688 CCCCAGGAGGGGAGCAGGGTGGG - Intergenic
1061090153 9:128421567-128421589 CCCCAGCACGGGGGCGGTGGGGG - Intronic
1062040349 9:134401694-134401716 CCCAGGGACGGGTGCAGCGAGGG - Exonic
1062347823 9:136123441-136123463 GCCAAGGATGGGGTCACTGTGGG + Intergenic
1062477086 9:136733653-136733675 CCGGAGGGCGGGGGCAGTGATGG + Intergenic
1203483067 Un_GL000224v1:24860-24882 TGTAAGGACAGGGGCAGTGTTGG + Intergenic
1203709614 Un_KI270742v1:85589-85611 TGTAAGGACAGGGGCAGTGTTGG - Intergenic
1203607034 Un_KI270748v1:67817-67839 CCACAGGACGGGGGCAGAGTCGG + Intergenic
1185449648 X:275556-275578 CTCCAGGACAGGGCCAGTGTGGG - Intergenic
1186730166 X:12401536-12401558 CCCAAAGACAGGGAGAGTGTTGG - Intronic
1190058838 X:47198103-47198125 CCCAAAGCTGGGGGCAGGGTTGG + Intronic
1194730481 X:97447582-97447604 CCCAAAGCAGGGGGCTGTGTGGG + Intronic
1198761130 X:140033379-140033401 CCCATGAAAGGGGGCAGTTTTGG + Intergenic
1201164574 Y:11197109-11197131 TGTAAGGACAGGGGCAGTGTTGG - Intergenic