ID: 950590856

View in Genome Browser
Species Human (GRCh38)
Location 3:13935009-13935031
Sequence CCTGAGAAGGAGGAACTGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 507
Summary {0: 1, 1: 1, 2: 8, 3: 61, 4: 436}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950590844_950590856 25 Left 950590844 3:13934961-13934983 CCCACTGAGGACATGGGAGAGGA 0: 1
1: 0
2: 2
3: 26
4: 311
Right 950590856 3:13935009-13935031 CCTGAGAAGGAGGAACTGGCCGG 0: 1
1: 1
2: 8
3: 61
4: 436
950590849_950590856 -9 Left 950590849 3:13934995-13935017 CCAGCGAGGAGGCCCCTGAGAAG 0: 1
1: 0
2: 3
3: 14
4: 162
Right 950590856 3:13935009-13935031 CCTGAGAAGGAGGAACTGGCCGG 0: 1
1: 1
2: 8
3: 61
4: 436
950590845_950590856 24 Left 950590845 3:13934962-13934984 CCACTGAGGACATGGGAGAGGAT 0: 1
1: 0
2: 2
3: 25
4: 254
Right 950590856 3:13935009-13935031 CCTGAGAAGGAGGAACTGGCCGG 0: 1
1: 1
2: 8
3: 61
4: 436

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950590856 Original CRISPR CCTGAGAAGGAGGAACTGGC CGG Intergenic
900095382 1:938064-938086 CCAGAGTCGGAGGCACTGGCTGG + Intronic
900247812 1:1646716-1646738 CCTGAGAAGCAGAGACTGGTGGG - Intronic
900259039 1:1713870-1713892 CCTGAGAAGCAGAGACTGGTGGG - Intronic
900299662 1:1970337-1970359 TCTCACAAGGAGGGACTGGCGGG - Intronic
900388312 1:2420557-2420579 CCTGAGAAGCTGGACCTGGCAGG - Intergenic
900389952 1:2429456-2429478 CCTGAGAGTGAGGAGTTGGCGGG + Intronic
900500795 1:3003575-3003597 CCTGCGGAAGAGGAACTGCCGGG + Intergenic
900758061 1:4451241-4451263 ACTGGGAAGGAGGAAGGGGCTGG - Intergenic
901067768 1:6502549-6502571 CCTCAGCCGGAGGAAGTGGCCGG - Intronic
901219596 1:7575888-7575910 CCAGGGAAGCAGGAACTGGAGGG - Intronic
902211863 1:14910336-14910358 CCTGAGACGGAGGAGTTGGTAGG - Intronic
902434651 1:16390410-16390432 GCTGAGAAGGAGGAGCAGGCAGG - Intronic
902615052 1:17619172-17619194 CCTGAGAAGGAGCTACCGGGCGG + Intronic
903003751 1:20284722-20284744 CCAGAGAAGGTGGCAGTGGCAGG - Intergenic
903036547 1:20496684-20496706 CCGGAGCAGGAGGAAGTGGAGGG - Intergenic
903687607 1:25143382-25143404 TCTGAGGAGGAGGCACTGGCAGG - Intergenic
903954116 1:27013024-27013046 CCTGAGAAGGAGGGCGGGGCAGG - Intergenic
904102212 1:28041065-28041087 CCTGACAAGAAGGAAATGGCTGG + Intronic
904458989 1:30664267-30664289 CCAGAGCAGAAGGAACTTGCTGG + Intergenic
905003216 1:34689696-34689718 CCTGAGAAGGAGCAATTGTAGGG - Intergenic
906166262 1:43688691-43688713 CCAGAGAATGGGGTACTGGCAGG + Intronic
906241664 1:44245853-44245875 CCAGGGAAGGAAGAACTGGCTGG - Intronic
906536117 1:46551841-46551863 CCTGAGGAGGAAGAACGAGCTGG + Intergenic
906551294 1:46668330-46668352 CCTGAGGAGGAGGAGGAGGCGGG - Exonic
907313352 1:53552384-53552406 CCTGAGAAGGAAGGCCTGGCGGG - Intronic
907496287 1:54846991-54847013 CCTGAGAAGGAGGAGCTCCAAGG - Intergenic
908216943 1:61963701-61963723 GCTGAGGAGGAGGAAGAGGCAGG + Intronic
911055568 1:93705574-93705596 CCTGAGAAGGGAGCAGTGGCTGG - Intronic
911189797 1:94936405-94936427 CATGAGAAAGAGAAAGTGGCAGG - Intergenic
911811197 1:102284315-102284337 CCAGAGCAGGAGGAAGTGGGTGG + Intergenic
913320321 1:117583311-117583333 CCCTCCAAGGAGGAACTGGCTGG + Intergenic
913390713 1:118308817-118308839 CTTGGAAAGGAGGAACTGACAGG - Intergenic
913498622 1:119450413-119450435 GCTGGGAAGGATGCACTGGCAGG - Intergenic
913517123 1:119614187-119614209 GCTGGGAAGGATGCACTGGCAGG - Intergenic
913694867 1:121315063-121315085 CCCGAGGGTGAGGAACTGGCGGG + Intronic
914706798 1:150176904-150176926 CATGAAAAGGAAGAGCTGGCCGG + Intergenic
915929637 1:160051868-160051890 GGTGAGAAGGAGGAACGGGTCGG - Intronic
916704805 1:167338175-167338197 GCTGAGAAGGAGGAACAGGAGGG - Intronic
916992815 1:170263095-170263117 GTTGAGAAGGAGAAAATGGCTGG - Intergenic
917278966 1:173361100-173361122 CTTGTGAAGGAGGAAATGGGAGG + Intergenic
917692402 1:177482741-177482763 CCAGACATAGAGGAACTGGCAGG + Intergenic
917844176 1:179006585-179006607 CCTCAGAAGCAGGACCAGGCCGG + Intergenic
918311430 1:183288188-183288210 TCTGAGAAGTAGAAAATGGCTGG + Intronic
919781849 1:201226134-201226156 CCTGAGAGGGAGGAGCAGGCAGG + Intronic
920353434 1:205352789-205352811 CCAGTGAAGGAGGGAGTGGCAGG + Intronic
920716336 1:208343812-208343834 CCTGGGAAGGAGGCACAGGATGG - Intergenic
920847532 1:209606587-209606609 CCTGAGACGGATGAATTGGCTGG - Intronic
922675825 1:227548230-227548252 CATCAGAAGGAGGAGGTGGCAGG + Intergenic
922704220 1:227780529-227780551 CCTGAGGAGGATGAAGGGGCTGG + Exonic
923766849 1:236900458-236900480 CCACAGAAGGAGGAAGTGGAAGG + Exonic
1062927218 10:1326408-1326430 ACTGAGAAGGGTGATCTGGCAGG + Intronic
1063150683 10:3333615-3333637 CCTGAGAGGCAGGAGCTGGTGGG + Intergenic
1063818016 10:9799262-9799284 GCTGAGAAGGAGGAAGAGGAGGG + Intergenic
1065787415 10:29229537-29229559 CCTGGGGAGGAGGCTCTGGCAGG + Intergenic
1066181129 10:32961657-32961679 CTGAAAAAGGAGGAACTGGCAGG - Intronic
1067040823 10:42952250-42952272 ACAGAGAAGGTAGAACTGGCCGG - Intergenic
1067555550 10:47267399-47267421 TCAGAGAGGGAGGAAGTGGCTGG + Intergenic
1068882878 10:62068468-62068490 TCTGAGGAGGAGGAGGTGGCTGG - Intronic
1069942294 10:71964200-71964222 GAGGAGAAGGAGGAGCTGGCGGG - Intergenic
1070404903 10:76085967-76085989 CATGAGAAGGAGGAGGTGGGAGG - Intronic
1070795686 10:79215021-79215043 TCTCAGAAGTAGGGACTGGCAGG - Intronic
1072842514 10:98790338-98790360 ACTCAGAAGGTGGAACTGGAGGG + Intronic
1072881707 10:99234839-99234861 TTTAAGGAGGAGGAACTGGCGGG + Intronic
1074224236 10:111467978-111468000 TCTGAGAAGAAGGCACTGGCTGG - Intergenic
1074968112 10:118511299-118511321 CCTGAGGAGGAGGAAAGGGAGGG + Intergenic
1075103463 10:119521914-119521936 CCTGAGAAGGGGGGTCTGGCAGG - Intronic
1075427263 10:122351453-122351475 CCTGAGAAGGGAGGACAGGCAGG - Intergenic
1075802526 10:125161518-125161540 CCTGAGAAGGCAGAAGCGGCCGG - Intergenic
1075843198 10:125522283-125522305 GCTGAGAAGACGGAACTGGAGGG + Intergenic
1075918685 10:126191483-126191505 ACTGGGAAGGAGGAGCTGGATGG + Intronic
1076143962 10:128102147-128102169 CTTGAGAAGGGGAAACTGTCTGG - Intronic
1077198053 11:1291402-1291424 ACTGGGAAGGAGGAACTGGCGGG - Intronic
1077259330 11:1607416-1607438 CCTGAGAAGGTTGAAGTGGTGGG + Intergenic
1077398983 11:2343689-2343711 CCAGTGTAGGAGGAACTGTCTGG - Intergenic
1078020854 11:7654959-7654981 CCTGAGAAGGAGGGGCAGGAGGG + Intronic
1079588824 11:22157684-22157706 CCTCAGAAGGAGCATCTGGAAGG + Intergenic
1080423749 11:32137633-32137655 CCTGAGAAAGAGAATATGGCTGG + Intergenic
1080492821 11:32784671-32784693 TCTGAAAAGGAAGAAATGGCAGG + Intronic
1080853399 11:36090911-36090933 CTTAGGAAGGAGGAACTGACAGG + Intronic
1081600412 11:44488683-44488705 CCTGGGAGGAAGGATCTGGCAGG + Intergenic
1081681423 11:45008153-45008175 CCAGAGAAGGAGGAGGTAGCTGG - Intergenic
1083372350 11:62192443-62192465 CCTGAGAAGGAGGAACATGCAGG - Intronic
1083378239 11:62243672-62243694 CATGAGAAGGAGGAACATGCAGG - Intronic
1084692134 11:70733752-70733774 CCCGGGAAGGAGGGCCTGGCAGG + Intronic
1084868543 11:72080275-72080297 CCTGAGAGGGAGGAGCCGGGGGG - Intronic
1085033734 11:73287959-73287981 CCTGAGACTGAGGAACTGTGTGG - Intronic
1085259496 11:75196068-75196090 CCAGAGAGGCAGGAACAGGCTGG + Intronic
1087516616 11:99171455-99171477 CATGACAATGAGGAATTGGCTGG - Intronic
1089190231 11:116648405-116648427 CTTGAGAGGGAGGACCTGGGAGG - Intergenic
1089605847 11:119640776-119640798 CAGCAGAAGGAGGAACTGGAAGG - Intronic
1091600105 12:1912828-1912850 CCTGTGAAAGAGGAAATGACAGG - Intronic
1091843256 12:3635307-3635329 CTGGAGAAGGAGTACCTGGCTGG + Intronic
1092161367 12:6317161-6317183 CCTGGGAGGGAGGGACTGTCAGG + Intronic
1092217577 12:6693960-6693982 CCTGAGGAGGGGGAAAGGGCAGG + Exonic
1094206991 12:27851124-27851146 GCTGAGATGGATGAACTGACAGG - Intergenic
1094273655 12:28645128-28645150 GCTGAGATGGATGAACTGACAGG - Intergenic
1094322892 12:29204758-29204780 CCAGAGCAGGAGGAAATGGGTGG + Intronic
1094428952 12:30345749-30345771 CCTGATAAGGAGCAACTGGTTGG + Intergenic
1094635905 12:32227068-32227090 ACTGTGAAGGAGGAGGTGGCTGG + Intronic
1097057561 12:56258753-56258775 ACAGACTAGGAGGAACTGGCGGG + Intergenic
1097279968 12:57839069-57839091 CATATGAAGGAGGAACTGGTTGG - Intronic
1097681596 12:62654776-62654798 TATGAGGAGGAGGAAATGGCTGG - Intronic
1101296103 12:103425065-103425087 ACTGGGAAGTAGGAACTGGACGG + Intronic
1101296234 12:103425863-103425885 ACTGGGAAGTAGGAACTGGACGG - Intronic
1101316396 12:103632808-103632830 CCTGTGAAGGAGAAACTCACAGG + Intronic
1102079405 12:110085902-110085924 CCTGAGAGGGAGAAAGTGGAAGG + Intergenic
1103463492 12:121123523-121123545 CCTGAGAGGGAGAAAGTGGAAGG - Intergenic
1103729821 12:123020030-123020052 CCTGCGAGGCAGGAAGTGGCAGG + Intronic
1103841599 12:123869700-123869722 CCTGAGAAGGAGGAAGGGGCTGG - Intronic
1103870025 12:124084771-124084793 GCTGAGAAGGAGAAGCTGGTAGG + Intronic
1103967777 12:124651160-124651182 GCTGAGAGGAAGGAGCTGGCTGG + Intergenic
1104021469 12:124994740-124994762 CTTGAGAAGGAGGAAGTTACTGG + Intronic
1105408308 13:20149894-20149916 GCTGAGAGGGAGCAACAGGCTGG + Intronic
1105708869 13:22986112-22986134 CCTGAGAAGGCAGAATTGCCAGG + Intergenic
1106288439 13:28338472-28338494 TCTGAGCTGGAGGAACTGGAAGG + Intronic
1107034339 13:35884749-35884771 CCTGAGAAAGTGGAAATGGTTGG + Intronic
1107403900 13:40095435-40095457 CATGAGAAGCAGGGACTGGATGG + Intergenic
1108171622 13:47747958-47747980 CCTGACAAGGAGAAGCTGGCAGG - Intergenic
1109786473 13:67182136-67182158 CCTGAGAAGGAGGATATAGCAGG - Intronic
1110838676 13:80115294-80115316 CCTGAGCAATAAGAACTGGCCGG - Intergenic
1111410862 13:87874795-87874817 CCTGGTAAGCAGGAAATGGCAGG + Intergenic
1112115757 13:96351434-96351456 CCTGAGAAGCTGGAACTAGAGGG + Intronic
1113357381 13:109594479-109594501 CCTGAGAGGGTAGAAATGGCAGG - Intergenic
1113444708 13:110356436-110356458 TGTGAGGAGGAGGGACTGGCAGG - Intronic
1113879429 13:113615465-113615487 CCTGAGGACGAGGCACAGGCCGG - Intronic
1114042987 14:18695985-18696007 CCTGAGAAGAAGGAGCGAGCTGG + Intergenic
1114047278 14:18886425-18886447 CCTGAGAAGAAGGAGCGAGCTGG + Intergenic
1114824372 14:26059022-26059044 CCTGAGATGGGGGAAATGACTGG + Intergenic
1115453535 14:33575880-33575902 CCTGAGAAAGAGAAAATGGAAGG + Intronic
1116309415 14:43304201-43304223 GCTGAGAAGAAGGAAGTGGAGGG + Intergenic
1119019310 14:71093758-71093780 GCTGAGAAGGAGGAAGAGGAGGG - Intronic
1119166186 14:72495832-72495854 ACAGGGAAGGAGAAACTGGCTGG - Intronic
1119207197 14:72803224-72803246 CCTGAGAGAGAGGCAGTGGCAGG - Intronic
1119260170 14:73233451-73233473 CCTGAGAAACAAGAATTGGCAGG - Intergenic
1119845453 14:77826185-77826207 CCTGGGAAGGGGGAGCTGGCTGG + Intronic
1120032153 14:79654057-79654079 TCAGATAAGGAGGAACTGGCTGG - Intronic
1120689388 14:87575917-87575939 CATGAGATGGAGGAAGTGCCTGG + Intergenic
1121823318 14:96989374-96989396 CCTGAGAAGGAGCATCTGAAGGG - Intergenic
1121973034 14:98376465-98376487 CTGGAGAAGGAGGAACTATCTGG - Intergenic
1202903293 14_GL000194v1_random:55222-55244 ACTGAGAAGGAGGAGCTGTGGGG - Intergenic
1202906019 14_GL000194v1_random:72915-72937 CCTGAGAAGGAGGGCCTGTCTGG - Intergenic
1123416071 15:20096335-20096357 CCTGAGAAGGAGGATCTGGATGG - Intergenic
1123525411 15:21103444-21103466 CCTGAGAAGGAGGATCTGGATGG - Intergenic
1123707281 15:22959522-22959544 CCTGAGCAGGCGGGACTGCCCGG - Intronic
1124492345 15:30165758-30165780 CCAGAGCAGGAGGAAGAGGCAGG - Intergenic
1124751191 15:32372559-32372581 CCAGAGCAGGAGGAAGAGGCAGG + Intergenic
1126697908 15:51341452-51341474 CCTGCGGAGGAGGGGCTGGCAGG - Intergenic
1128219885 15:65961634-65961656 CCTGGGAAGGAAGAAGTGGCTGG - Intronic
1128226797 15:66007379-66007401 CCTGACAAGGAGAACCTAGCAGG - Intronic
1128787710 15:70410503-70410525 CCCCAGAAGGAGGACTTGGCAGG - Intergenic
1129073684 15:72973317-72973339 CCTGAGAAGGAGAAGCATGCTGG + Intergenic
1129117777 15:73374850-73374872 CCAGAGAGGGAGGCACTGGGAGG + Intergenic
1130809843 15:87365335-87365357 ACTAGGAAGAAGGAACTGGCAGG + Intergenic
1131026089 15:89142803-89142825 GCTGGGAAGGAGGAACATGCAGG + Intronic
1131633634 15:94206630-94206652 CCAGAGCAGGAGGAACATGCTGG - Intergenic
1132570650 16:642483-642505 CCTGCGACCCAGGAACTGGCCGG - Intronic
1133015212 16:2936609-2936631 GGTGAGAGGGAGGACCTGGCGGG - Intronic
1133094634 16:3434291-3434313 CCTCAGTGGGAGAAACTGGCAGG - Exonic
1134562013 16:15219040-15219062 CCTGAGGAGGGGGAAGTGGGTGG - Intergenic
1134922551 16:18130666-18130688 CCTGAGGAGGGGGAAGTGGGTGG - Intergenic
1135246024 16:20857792-20857814 CCTCTGAAGGAGGAACTGTCAGG + Exonic
1135395455 16:22128272-22128294 GCTGTGAAGGAGGAACTGAAGGG + Intronic
1135778052 16:25274494-25274516 CCTGAGATCGAGGTATTGGCAGG + Intergenic
1135986050 16:27185129-27185151 CCAGAGCAGGAGGAAGCGGCAGG + Intergenic
1137569680 16:49557414-49557436 AATGAGAAGGAGGAACTCCCGGG + Intronic
1137686504 16:50390553-50390575 CCTGAGCAGGAGGGGATGGCAGG - Intergenic
1138381751 16:56607648-56607670 CCTGGGAGGGAGGAACTAGCGGG - Intergenic
1138885554 16:61073718-61073740 CCTGAGAAGGAGGGTCTTACTGG - Intergenic
1139336984 16:66239602-66239624 TCTGACAAGGAGGAGTTGGCTGG - Intergenic
1140785774 16:78340628-78340650 CCTCTGAAGGATGATCTGGCTGG + Intronic
1141126954 16:81407708-81407730 CATGTGAAGGAAGACCTGGCAGG - Intergenic
1141439619 16:84021359-84021381 CTTGAAAGGGATGAACTGGCCGG - Intronic
1141552519 16:84815654-84815676 CCAGAGAAGGAGGAAATAGACGG + Intergenic
1141624894 16:85255982-85256004 ATTGAGAAGTAGGCACTGGCCGG - Intergenic
1141827691 16:86492787-86492809 TCTGAGAGGGAGGCACTGGGTGG - Intergenic
1142240555 16:88942677-88942699 CAGGAGCTGGAGGAACTGGCTGG - Intronic
1142401092 16:89859105-89859127 CATGGGCAGGAGGCACTGGCGGG + Intronic
1142527856 17:557253-557275 CGTGAGAAGGAGGCAGAGGCTGG - Intronic
1142698429 17:1645825-1645847 CCTGAGAGGGAGGGGGTGGCTGG + Intergenic
1142958099 17:3534989-3535011 CCAGAGAAGGAGGGGCTGGGAGG - Intronic
1143030006 17:3962668-3962690 CCAGCGGAGGAGGAACTGACTGG - Intronic
1143563543 17:7708718-7708740 CCTGGGAAGGAGAACCTGCCAGG + Exonic
1147042789 17:37731177-37731199 CCAGAGATGGAGGAGGTGGCCGG + Intronic
1148559724 17:48598926-48598948 CCAGAAGAGGAGGAGCTGGCAGG + Intronic
1148895275 17:50835861-50835883 CCTGAGAAGAAGGCCCTGGTGGG + Exonic
1149604570 17:57915796-57915818 CCTGGGAAGGCGGAACAAGCTGG + Intronic
1149664869 17:58358370-58358392 CCTGAGCTGGAGTCACTGGCTGG + Exonic
1150843371 17:68630420-68630442 CCTGAGAGGCAGGAACATGCAGG + Intergenic
1151643176 17:75411466-75411488 ACTGAGAAGGTGGCACTGGCTGG - Intergenic
1151801359 17:76381808-76381830 CCTGAGGAGGAGGAAGCAGCAGG - Intronic
1151835761 17:76581683-76581705 CCTGAGAGGGAGGGGCTGGAAGG - Intronic
1151876451 17:76870097-76870119 CCCGAGAAGGCGGAGCTTGCAGG + Intronic
1152121164 17:78419524-78419546 CCTGAGGAAGAGGAACAGACAGG - Exonic
1153488580 18:5627012-5627034 GCTCAGAAGGTGGAACTGGAAGG + Intronic
1154373158 18:13784762-13784784 GCTGAGGAGGAGGAAGTGGAGGG - Intergenic
1156587771 18:38450966-38450988 GATGATAAGGAGGAACAGGCCGG - Intergenic
1157532933 18:48437405-48437427 CCTGGGAAGGAAGAAATGGAGGG + Intergenic
1157583649 18:48787639-48787661 CCTGAGAAGGAAGAAGAGGCAGG + Intronic
1158617805 18:59004212-59004234 CCTGAGATCAAGGCACTGGCAGG - Intergenic
1159548721 18:69872613-69872635 ACTGAGAAGAAGGAATTGGAGGG - Intronic
1159834625 18:73324116-73324138 ACTGAGAAGGAGGAAGAGGAAGG - Intergenic
1160025606 18:75212501-75212523 TCTCTGGAGGAGGAACTGGCAGG + Intronic
1160563542 18:79773132-79773154 CCTGGGCAGGAGGACCTGGCTGG - Intergenic
1162548539 19:11345628-11345650 CCTGGGAAGGAGGCACCGGGTGG + Exonic
1162790067 19:13058124-13058146 CCAGAGAAGCAGGAGCTGGGAGG - Intronic
1163029849 19:14537085-14537107 CCTGAGGAGGAGGAGGGGGCAGG + Intronic
1163094100 19:15043155-15043177 CCCAAGAAGGAAGAACTGGGTGG - Intergenic
1163119147 19:15206009-15206031 CCTGATCACGAGGAAATGGCAGG - Intergenic
1163296440 19:16415844-16415866 CCTGAGAATCAGGACCGGGCAGG - Intronic
1164398917 19:27889464-27889486 CCTGAGAAGGAGGAGATATCAGG + Intergenic
1165751877 19:38265064-38265086 TCTGAGCAGGGAGAACTGGCGGG + Intronic
1166042597 19:40212882-40212904 CCAAAGAAGGAAGAACTGGTCGG + Exonic
1166713467 19:44951659-44951681 CCTGAGGAGAAGGGACTGGGGGG - Intronic
1166885049 19:45955332-45955354 CCTGAGAAGGAGAGACAGACAGG + Intronic
925425913 2:3748477-3748499 CCTGACAAGGGGGAAGTGGGAGG + Intronic
925542491 2:4980689-4980711 ACTGATAAGGAGGAGCTGGAGGG + Intergenic
925625838 2:5841645-5841667 CCTGAACAGTAGGAACTGGCTGG - Intergenic
927441267 2:23119673-23119695 CTTGTGAAGGAGAAGCTGGCAGG - Intergenic
928148376 2:28804052-28804074 CCTGAGAAGGAGGATGTGCAGGG + Intronic
931529399 2:63197148-63197170 GCTGAGAAGGAGGAAGAGGAGGG - Intronic
931627453 2:64269832-64269854 CCTGAGGAGGAGGAAGAGGAGGG - Intergenic
932493075 2:72133744-72133766 CCTGCGATGGAGGAAGGGGCTGG - Intronic
933197860 2:79412780-79412802 ATTGAGAAGGAGAAACTGGATGG + Intronic
933789936 2:85875739-85875761 TCTGGGAAGGGGGAACTGGAAGG + Intronic
933833992 2:86231398-86231420 GCTGAGAGGGAGGAAATGGACGG + Intronic
933911893 2:86948435-86948457 TTTGAAAAGGGGGAACTGGCCGG + Intronic
934011102 2:87821459-87821481 TTTGAAAAGGGGGAACTGGCCGG - Intronic
934026175 2:88003268-88003290 CCTGAGGAGGAGGCACGGGGAGG - Intergenic
934129739 2:88936573-88936595 CTTAAAAAGAAGGAACTGGCTGG - Intergenic
934500582 2:94857602-94857624 CCTGAGGAGGAGGGCCTGTCTGG + Intergenic
934883830 2:98007377-98007399 CCTGAGAAGGGGGCTGTGGCTGG + Intergenic
935293744 2:101630614-101630636 GCAGAGAAGGAGGCATTGGCTGG - Intergenic
935774665 2:106462175-106462197 TTTGAAAAGGGGGAACTGGCCGG - Intronic
935870712 2:107446182-107446204 CTTGAGAATGAAGAACTGGTAGG + Intergenic
935905402 2:107833740-107833762 TTTGAAAAGGGGGAACTGGCCGG + Intronic
935991769 2:108725463-108725485 TTTGAAAAGGGGGAACTGGCTGG + Intronic
936127195 2:109798972-109798994 TTTGAAAAGGGGGAACTGGCGGG + Intronic
936217502 2:110572514-110572536 TTTGAAAAGGGGGAACTGGCGGG - Intronic
936426645 2:112427089-112427111 TTTGAAAAGGGGGAACTGGCCGG - Intronic
937114765 2:119397283-119397305 CCTGAGGAGGAGGAACAGGCTGG + Intergenic
937814327 2:126234429-126234451 CCTAAGGAGGAGGATTTGGCGGG - Intergenic
938507540 2:131902222-131902244 CCCCAAACGGAGGAACTGGCTGG - Intergenic
938563445 2:132495340-132495362 GCTGGGAAGGAGGCACTAGCTGG + Intronic
938629803 2:133154136-133154158 TTCAAGAAGGAGGAACTGGCCGG - Intronic
938672360 2:133598402-133598424 CCTCAAATTGAGGAACTGGCTGG + Intergenic
941267925 2:163386657-163386679 TCTGAGAAAGAGAAAATGGCTGG + Intergenic
941462961 2:165793655-165793677 CCTGAGAGGGAGGGCCCGGCGGG - Intronic
945305363 2:208254690-208254712 CCTGGGAGGGAGAAACTGGGCGG - Intronic
947210241 2:227701707-227701729 CCAGAGAAGGAGGCAAGGGCTGG + Intronic
947807349 2:232977755-232977777 CCCGAGCAGGAGGCACAGGCGGG + Intronic
947895732 2:233670242-233670264 GCTGAGAAGGAGGAAGAGGTGGG + Intronic
948213302 2:236210798-236210820 CCTGTGAAGGAGGCAGTGGAGGG + Intronic
948674080 2:239587038-239587060 ACAGAGATAGAGGAACTGGCCGG - Intergenic
948844978 2:240678788-240678810 CCTGAGAACGGGGACCTGGCAGG - Intronic
948848882 2:240696091-240696113 CCTGAGAACGGGGACCTGGCAGG + Intronic
1168763020 20:362596-362618 CCTGTGATGGAAGAACTGACAGG + Intergenic
1169149368 20:3277193-3277215 CCTGAGTAGGAGGATCTGAGTGG - Intronic
1169483564 20:6006674-6006696 CCTGAAAAGAAGTTACTGGCAGG + Intronic
1169826854 20:9777976-9777998 CATGAGAATGAGGAAATGCCTGG + Intronic
1169859345 20:10135096-10135118 GCTGAGTAGCAGGACCTGGCTGG + Intergenic
1170322541 20:15116267-15116289 GCTGAGGAGGAGGAACAGGAGGG - Intronic
1171891805 20:30724304-30724326 CCTGAGAAGGAGAGCCTGTCTGG + Intergenic
1172025748 20:31947195-31947217 CATGAGCAGGTGGAATTGGCTGG - Intronic
1172166660 20:32903747-32903769 CTGGAGATGAAGGAACTGGCTGG + Intronic
1172595556 20:36148910-36148932 GCAGAGAAGAAGAAACTGGCTGG + Intronic
1172598243 20:36165400-36165422 GCTCAGAAAGAGGAAGTGGCTGG + Intronic
1172904695 20:38360417-38360439 CCTGAGGAGGGGGCACTGGCTGG - Intronic
1173250182 20:41360297-41360319 CCTGAGAAGGAGCCACCAGCTGG - Exonic
1173261330 20:41438962-41438984 CCTGAGAATGTGGCACTGCCAGG - Intronic
1173518516 20:43682289-43682311 CCTGAGAAGGAGGTCCTGAGGGG - Intronic
1173824119 20:46036570-46036592 CTTGAGAAGAAGGACTTGGCAGG + Intronic
1173939737 20:46900249-46900271 CCAAAGAATGAGGAACTGGAGGG + Intronic
1174064345 20:47853719-47853741 TCTCAGAAGCAGGAACTGGGGGG + Intergenic
1175402480 20:58708392-58708414 CCTGGGCAGGAGGGGCTGGCAGG + Intronic
1175947378 20:62565217-62565239 CCTGGCAAGGAGGAACAAGCAGG - Intronic
1176053502 20:63133166-63133188 CCTGAGCTGGTGGAACTGGCCGG + Intergenic
1176273070 20:64246566-64246588 CCAGAGCAGGTGGGACTGGCTGG + Intergenic
1176423509 21:6533811-6533833 CCTGGGAAGATGGAACTGGAGGG + Intergenic
1176622658 21:9069990-9070012 ACTGAGAAGGAGGAGCTGTGGGG - Intergenic
1176625374 21:9087671-9087693 CCTGAGAAGGAGGGCCTGTCTGG - Intergenic
1176977236 21:15335468-15335490 CCTGAGTAGGAACACCTGGCAGG - Intergenic
1178944983 21:36939582-36939604 CCTTACAGGGAGGAACTGTCTGG - Intronic
1179388101 21:40961079-40961101 CCTGAGATGGAGGAATGGGGTGG + Intergenic
1179699003 21:43142127-43142149 CCTGGGAAGATGGAACTGGAGGG + Intergenic
1180031379 21:45210818-45210840 CAGGAAAAGGAGGAGCTGGCAGG + Intronic
1180085901 21:45507776-45507798 GCTGAGACGGAGGTACTGGGGGG - Intronic
1180465811 22:15609080-15609102 CCTGAGAAGAAGGAGCGAGCTGG + Intergenic
1181054990 22:20256651-20256673 CCTGGGAGGGAGGCACCGGCTGG - Intronic
1181894867 22:26098351-26098373 CCTGAGAAGGAGAAGATGCCTGG + Intergenic
1182345863 22:29664308-29664330 CCTGAGAGGGAGGAAGGGGTGGG - Intronic
1182543619 22:31059665-31059687 CCTGAGAAGGAGGATCTGGATGG + Intergenic
1182922222 22:34090332-34090354 CTCAAGAAGGAGGAACTGACTGG + Intergenic
1183772347 22:39938050-39938072 CATAAGAAGAAGGAAGTGGCTGG + Intronic
1183987016 22:41575559-41575581 GCTGAGGAGGAGGGACTGGCCGG - Exonic
1184259095 22:43304480-43304502 TGTGAGAAGCAGGAACAGGCAGG + Intronic
1184262179 22:43324737-43324759 CCAGAGAACGAGAAACAGGCAGG + Intronic
1184422386 22:44389569-44389591 CCTGGGCAGGAGGAGCTGGTGGG + Intergenic
1185156040 22:49194100-49194122 CCTGAGAAGGAGGCATAGGAAGG + Intergenic
1185233009 22:49694078-49694100 TCTGAGCAGGAGGATCTGGGGGG + Intergenic
1185341150 22:50291738-50291760 CATGAGGAGGGGGCACTGGCAGG - Intronic
949310462 3:2691550-2691572 ACTGAGAATGAGGAACTCACAGG + Intronic
949797020 3:7862577-7862599 CCTTAGAGGGAGCGACTGGCTGG + Intergenic
950163500 3:10776953-10776975 GGTGAGCAGGAGAAACTGGCAGG - Intergenic
950571787 3:13804915-13804937 CCTGAGGAGGAGGAAGAGGAGGG - Intergenic
950590856 3:13935009-13935031 CCTGAGAAGGAGGAACTGGCCGG + Intergenic
950712056 3:14819831-14819853 CCTGAGAAGGAGGAGCTGGCCGG + Exonic
950865162 3:16182950-16182972 CTTGAGATGGAGGATCTGGCAGG + Intronic
950972329 3:17201713-17201735 CCAGAGAAGGAGGAAGTGAGGGG - Intronic
952752777 3:36838835-36838857 TCTGAGAAGGAGGAGCAGGAAGG + Intronic
953004467 3:38965346-38965368 CCTGGGAAGGAGGCCCTGCCAGG + Intergenic
953195720 3:40731407-40731429 CCTGAGCAGGTGGAAGTGGTAGG + Intergenic
953415168 3:42711639-42711661 GCAGAGATGGAGGAACTGGGAGG - Intronic
953863646 3:46565647-46565669 CCAGAGGAGGAGGAATTGTCTGG - Intronic
955195882 3:56804389-56804411 CCTGAGAAGTAGGAACTGCTGGG - Intronic
955375702 3:58394813-58394835 CTGAAGAAGGAGGAACTAGCTGG + Intronic
955902668 3:63774093-63774115 TATAAGAAGGAGAAACTGGCCGG + Intergenic
958730124 3:97952397-97952419 CCCAAGAGTGAGGAACTGGCCGG - Intronic
961629141 3:128283549-128283571 GCTGGGCAGGAGGAACTGGAAGG - Intronic
962419271 3:135214088-135214110 AAGGAGGAGGAGGAACTGGCGGG - Intronic
963016063 3:140825200-140825222 CCTGAGAATGGGGCTCTGGCTGG - Intergenic
963062825 3:141238914-141238936 GCTGAGAAGGAGGAAGAGGAGGG + Intronic
963471420 3:145747059-145747081 CCAGAGAAAGGGAAACTGGCAGG + Intergenic
963512696 3:146268703-146268725 TCTGAGAAGCAGGGACTTGCTGG - Intergenic
963747803 3:149142899-149142921 CCTGAGAAAGAGGATCTGAAGGG + Intronic
964311355 3:155396623-155396645 ACTGAGAAGGAGGAAGAGGAGGG + Intronic
965211874 3:165801103-165801125 CGTGAGAAAGATGAACAGGCTGG + Intronic
966118801 3:176498777-176498799 CATGTGAAGGAGGAACTGTCAGG + Intergenic
967078108 3:186023532-186023554 CCTGAGAAGGTGGAAGTGGGTGG + Intergenic
967218304 3:187228517-187228539 CAAGAGGAGGAGGTACTGGCGGG - Intronic
968447662 4:660461-660483 CCACAGAAGGAGGAGCTGCCAGG + Exonic
968758481 4:2428690-2428712 CCTGAGAAGGAGTGGCTGCCAGG - Intronic
969717906 4:8877336-8877358 CCTGAGGAGGAGGAGATGGGAGG + Intergenic
970071767 4:12167334-12167356 CCTGCAAAGGAGGAAATGGTAGG + Intergenic
971648496 4:29239579-29239601 ACTGAGAAGGTGGAAGTGGAAGG - Intergenic
971696805 4:29915256-29915278 CCAGATAAGGAGTAACTGACAGG + Intergenic
972913897 4:43852238-43852260 GCTGAGGAGGAGGAAGAGGCAGG + Intergenic
973336814 4:48964969-48964991 CCTGCTAAGGAGAAACTGACCGG - Intergenic
974003947 4:56537172-56537194 CCTGAGAAGGAGAAACAGTCAGG - Intronic
975392810 4:73838910-73838932 GCTGTGAAGGAGTAACTGGAAGG - Intronic
975732789 4:77354048-77354070 CCTGTGGAGAAGGAACTGGCAGG + Intronic
975734379 4:77367144-77367166 CCTGTGGAGAAGGAACTGGCAGG + Intronic
981040856 4:140220185-140220207 TGTGTGAAGGAGGAACAGGCAGG + Intergenic
981465554 4:145067457-145067479 CCTGAGAAAGAGCTTCTGGCAGG + Intronic
981475854 4:145186105-145186127 TATCACAAGGAGGAACTGGCTGG + Intergenic
982068545 4:151675199-151675221 CCCGAGAAGGAGGGCCAGGCGGG + Intronic
984918885 4:184746873-184746895 CCTGAGAAAGAGAAAATGGAAGG + Intergenic
985693553 5:1326969-1326991 CCTGTGGAGGAGGAGCTGGATGG - Intronic
986680685 5:10230784-10230806 CCTGGGGAGGAGGAAGTGCCAGG - Intronic
986968865 5:13308264-13308286 ACTGACACGGAAGAACTGGCAGG + Intergenic
987231319 5:15896595-15896617 CAGAGGAAGGAGGAACTGGCAGG - Intronic
988483673 5:31650409-31650431 TCTGAGAAGCAGGAACTGCCTGG + Intronic
988510100 5:31857438-31857460 CCTGAGAAAGAGGACATGGGAGG + Intronic
988539202 5:32094080-32094102 CCTGAGAAGGAGGGAGGGGTTGG + Intronic
991416493 5:66397880-66397902 CATGAGAAGGAGAAACGGGAGGG + Intergenic
991629781 5:68644994-68645016 ACTGAGAAGTAAGAACTGGCAGG - Intergenic
993084896 5:83351136-83351158 CCGGAGAAGGAGGAAGCGGGGGG - Intronic
995397216 5:111699666-111699688 ACAGAGAAGGAGGAACTGGTGGG - Intronic
996060170 5:119024231-119024253 CATGAAAAGGAAGAACTGGGAGG + Intergenic
996238894 5:121170518-121170540 CCAGAGCAGGAGGAAGTGGCAGG + Intergenic
997690512 5:135824757-135824779 ACTGAGAAGGAGGCACGGGCTGG + Intergenic
1001584993 5:172827870-172827892 CCAGAGAAGGAGGTATTGGGAGG - Intergenic
1001775243 5:174324002-174324024 CCTGAGTCAGAGGAGCTGGCAGG + Intergenic
1001931686 5:175677738-175677760 CATGAGAATGAGGAACTGGGCGG + Intronic
1002288622 5:178182722-178182744 CCTGACCAGGTGCAACTGGCTGG - Intergenic
1002435147 5:179226914-179226936 CCTGAGCAGGAGGAATGGGCAGG + Intronic
1003110806 6:3250698-3250720 CCTGAGAAGGAGGGACCTGGAGG + Intronic
1003557401 6:7152640-7152662 CCAGAGAATGAGGCACTGGAGGG + Intronic
1003618371 6:7675139-7675161 CTAGAGAGGGAGGAAATGGCTGG + Intergenic
1005186981 6:23173576-23173598 TCTGAGAAGGAGGCACTGGCTGG - Intergenic
1006396468 6:33790460-33790482 CCTGAGGTGGAGCAAGTGGCAGG - Intergenic
1007087490 6:39159300-39159322 GGAGAGAAGGAGGAACTGGCAGG + Intergenic
1007341294 6:41192901-41192923 CCTGAGAAGAAGGGACAGGGTGG + Exonic
1007525289 6:42487214-42487236 CCTGAGCAGGAGGGTCTGACTGG - Intergenic
1007995373 6:46302236-46302258 CCTGAAATGGAGAAAATGGCAGG + Intronic
1008167132 6:48152321-48152343 CCCCAAAAGGAGGGACTGGCTGG + Intergenic
1011186431 6:84681799-84681821 CCTCAGAAGGAAGAACTCGATGG + Intergenic
1011587762 6:88945082-88945104 CCTGAGAAGGAGGCAGGGGTTGG - Intronic
1012644391 6:101661235-101661257 GCTGAGAAGTTTGAACTGGCTGG - Intronic
1012704154 6:102499855-102499877 CATGTGGATGAGGAACTGGCTGG - Intergenic
1013366380 6:109441012-109441034 CCTGCGAAGAAGGAACGGTCTGG + Exonic
1015376322 6:132514054-132514076 CTTGAGAATTAGGAAGTGGCTGG + Intergenic
1015786558 6:136924458-136924480 CCGGGGAGGGAGGAAATGGCCGG + Exonic
1015864362 6:137712713-137712735 GTTGAGAAGGAGGCACTGCCAGG + Intergenic
1016078833 6:139831078-139831100 TTTAAAAAGGAGGAACTGGCAGG - Intergenic
1016321963 6:142856140-142856162 CCTGGTAAGGGGGAAATGGCAGG + Intronic
1016808217 6:148234527-148234549 AAGAAGAAGGAGGAACTGGCCGG + Intergenic
1017023287 6:150159123-150159145 CCTGAGCAGGTGGAAAGGGCTGG - Intronic
1017726847 6:157282240-157282262 CCTGAGTAGCTGGGACTGGCAGG + Intergenic
1018824973 6:167402045-167402067 CTGGAGAAGGAGGAACCGGAGGG + Intergenic
1019144319 6:169967095-169967117 CCTGAGAAGGAGAGACTCGCAGG + Intergenic
1019157761 6:170050511-170050533 CCTCATCTGGAGGAACTGGCTGG - Intergenic
1019161927 6:170074704-170074726 CCTGAGAAGGAGGGACAGCCTGG + Intergenic
1019771587 7:2886786-2886808 CCTGAGAGGGAGGGTCTGCCAGG + Intergenic
1020973670 7:14979982-14980004 TCTCAGAAGGGGGAACTGACTGG + Intergenic
1022170964 7:27830480-27830502 CCTTAGAATGAGGAACTGAATGG + Intronic
1023401785 7:39796520-39796542 CCTGAAGAGGAGAAACTGACTGG - Intergenic
1023517267 7:41014028-41014050 TCTGAGAAGGAGGCTTTGGCTGG + Intergenic
1024075766 7:45817165-45817187 CCTGAAGAGGAGAAACTGACTGG - Intergenic
1024246175 7:47472034-47472056 CCTGAGAAGGTGGAAGAGGCAGG - Intronic
1024276509 7:47681470-47681492 CCAGGGAAGGAGCAACTGACAGG + Intergenic
1024378241 7:48663785-48663807 TGAGATAAGGAGGAACTGGCTGG - Intergenic
1024647832 7:51384142-51384164 CCTGAAGAGGAGAAACTGACTGG + Intergenic
1024773780 7:52758282-52758304 CAAGACGAGGAGGAACTGGCTGG + Intergenic
1024937151 7:54721854-54721876 TCTGAGGAAGAGGACCTGGCTGG + Intergenic
1025051673 7:55738629-55738651 CCTGAAGAGGAGAAACTGACTGG + Intergenic
1025128635 7:56364296-56364318 CCTGAAGAGGAGAAACTGACTGG + Intergenic
1026405994 7:70065952-70065974 CCTGAGAAGGAGGCTGAGGCAGG - Intronic
1026555335 7:71403689-71403711 CTAGAGAAGGATGAACTGGCCGG + Intronic
1026879538 7:73900020-73900042 CGTGAGAAGGAGCAGCTGGTGGG - Intergenic
1027125749 7:75555601-75555623 CCTGAGCAGGATGACCTGGCTGG + Intronic
1028129456 7:87152738-87152760 CCTAAGAGGGAGGCCCTGGCCGG - Exonic
1028307711 7:89286978-89287000 GCTGAGAAGGAGGAAAAGGAGGG - Intronic
1028630251 7:92926443-92926465 CCTGAGAAGTTTGAACTGGGCGG - Intergenic
1030205968 7:106953094-106953116 TCTGAGCAGGAGGAAGTGGGTGG - Intergenic
1031557470 7:123195506-123195528 CCCTAGAAGGAGGAAGTGGTAGG - Intronic
1033030302 7:137819785-137819807 CATGTGCAGGATGAACTGGCAGG - Intronic
1033569391 7:142612730-142612752 TGTGATAATGAGGAACTGGCAGG - Intergenic
1033790790 7:144790569-144790591 CCAGAGCAGGAAGAAGTGGCAGG + Intronic
1035051238 7:156000130-156000152 ACTGTGAATGAGAAACTGGCGGG - Intergenic
1035175233 7:157045517-157045539 CCTGAGCCGGAGGAACTCTCTGG + Intergenic
1035835060 8:2741233-2741255 ACTGGAAAGGAGGAAGTGGCAGG + Intergenic
1036563728 8:9920285-9920307 CCTGACAAGGTAGAACTGACAGG - Intergenic
1036955001 8:13178445-13178467 CCTGAGTAGGTGGAACTAGGAGG - Intronic
1037110316 8:15157900-15157922 CCTGAGAAGGAGGAACAACAAGG - Intronic
1037617349 8:20531434-20531456 TCTGAGAAAGAAGAACTAGCAGG - Intergenic
1037730371 8:21518932-21518954 CCTGAGTTGGAGATACTGGCTGG - Intergenic
1038265929 8:26040101-26040123 GCTGTGAAGGAGGTAGTGGCAGG + Exonic
1038755163 8:30333782-30333804 CATGTGAAGGAAGAACTGACAGG + Intergenic
1039382588 8:37099948-37099970 CCTAGGAGGGAGGAACAGGCAGG - Intergenic
1039842287 8:41302800-41302822 CAGGAGAAGGAGGAGCTGGTGGG - Intronic
1040387157 8:46921322-46921344 CAGGGGAAGGAGGAACAGGCTGG + Intergenic
1040444284 8:47477925-47477947 GCTGGGAAGGAGGAATTGGAGGG + Intronic
1041024526 8:53670244-53670266 CCTGGGGAGGAGGAACCAGCAGG - Intergenic
1041794192 8:61729092-61729114 CCTGAGAAGGCTGAAAGGGCAGG + Intergenic
1041802268 8:61813164-61813186 TCAGAGAAGAATGAACTGGCCGG + Intergenic
1042158049 8:65865714-65865736 TCTGAGTAGGAGGATTTGGCTGG - Intergenic
1042449314 8:68925929-68925951 CCTGAAAAGGAGGGCCTGGAGGG - Intergenic
1042562646 8:70084612-70084634 CCTATGAAGGATGAACTGCCAGG + Intergenic
1042657866 8:71120113-71120135 CCAGAGTAGGAGGAAGTGGGGGG + Intergenic
1043138962 8:76564038-76564060 CCTGGGAAGGATGGACTGGGTGG - Intergenic
1043796304 8:84546065-84546087 TGTGAGAAGGAGGAAGTGGCAGG + Intronic
1044520394 8:93192847-93192869 CCTAAGGAAGAGGAATTGGCAGG - Intergenic
1045555845 8:103213741-103213763 AGTCAGAAGGAGGAACTGGGTGG - Intronic
1045948868 8:107829263-107829285 CCTGAGAATGAGGAGATGGTAGG + Intergenic
1046770502 8:118112176-118112198 CCGGGGAAGGAGGCACCGGCAGG + Intergenic
1047636367 8:126767597-126767619 CCTGAGCAGGAGGAAGTTGGGGG - Intergenic
1047728768 8:127708345-127708367 GCTGAAAAGCAGGAACTGGAAGG + Intergenic
1048091627 8:131247418-131247440 CCTGAGAAGCAGGGACTGCTGGG - Intergenic
1048524953 8:135193980-135194002 CCTGAGATGGGGGAACTTTCTGG - Intergenic
1049393174 8:142382441-142382463 CCCGAGCAGAAGGGACTGGCGGG - Intronic
1049614175 8:143569064-143569086 CCTGGGAGGGAGAAACTGGAGGG + Intronic
1050044999 9:1533836-1533858 CCTGGGAAAGGGGAGCTGGCAGG - Intergenic
1050112818 9:2234403-2234425 CCTGAGAAGCAGGGAGAGGCGGG - Intergenic
1051008343 9:12378202-12378224 CCTGACAACAAGGAACTAGCTGG + Intergenic
1053042343 9:34885367-34885389 CATCAGAAGGAGGAGGTGGCAGG - Intergenic
1053303626 9:36969056-36969078 TCTGACAAGGAGGAACTTGGTGG - Intronic
1053656589 9:40222946-40222968 CCTGAGAAGGAGGGCCTGTCTGG - Intergenic
1053906944 9:42852168-42852190 CCTGAGAAGGAGGGCCTGTCTGG - Intergenic
1054357008 9:64071393-64071415 CCTGAGAAGGAGGGCCTGTCTGG - Intergenic
1054368694 9:64369168-64369190 CCTGAGAAGGAGGGCCTGTCTGG - Intergenic
1054528025 9:66153339-66153361 CCTGAGAAGGAGGGCCTGTCTGG + Intergenic
1054676322 9:67858920-67858942 CCTGAGAAAGAGGGCCTGTCTGG - Intergenic
1055205478 9:73724182-73724204 GCTGAGAAGGAGGAAGAGGAGGG - Intergenic
1056578123 9:87871124-87871146 CCCCAGAAGGCAGAACTGGCTGG - Intergenic
1056893786 9:90521952-90521974 CCTGAGAAGGAGGAATGAGAAGG - Intergenic
1058533712 9:105933042-105933064 CCCCAGATGGAGGGACTGGCTGG + Intergenic
1058732578 9:107864519-107864541 CCTGAGAAGCAGGAACCTGGGGG - Intergenic
1059044960 9:110856363-110856385 CCTGTGAAGGAGTAACAGTCAGG - Intergenic
1059692101 9:116695595-116695617 CAGGAGAAGGAGGAAGTGGAGGG - Intronic
1060967097 9:127717489-127717511 CCTGAGAGGAGGGATCTGGCAGG - Intronic
1061196959 9:129111715-129111737 CATGACACGGAGGAACTGGAGGG + Intronic
1061480260 9:130894486-130894508 CCTGAAAAAGTGGGACTGGCCGG - Intergenic
1061706190 9:132455208-132455230 CCTTAAAAAGTGGAACTGGCTGG + Intronic
1062190416 9:135245159-135245181 GCTCAGAAGGTGGCACTGGCCGG + Intergenic
1062353909 9:136152931-136152953 GCTGAGGAGGGGGAACTGCCAGG + Intergenic
1203748548 Un_GL000218v1:58132-58154 CCTGAGAAGGAGGGCCTGTCTGG - Intergenic
1203561172 Un_KI270744v1:59888-59910 CCTGAGAAGGAGGGCCTGTCTGG + Intergenic
1186069091 X:5798355-5798377 GCAGAAAAGGAGCAACTGGCTGG - Intergenic
1186672322 X:11780372-11780394 CCTCAGGAGGAAGAACTGGGTGG + Intergenic
1187377808 X:18772246-18772268 GCTGAGGAGGAGGAAGAGGCGGG + Intronic
1187389585 X:18877198-18877220 CCTGAGGAGGGAGAACAGGCAGG + Intergenic
1188581915 X:31724221-31724243 CCTGAGAGGAAGATACTGGCTGG + Intronic
1189300125 X:39946513-39946535 CATGAGAAGGAGGAAAGGGAAGG - Intergenic
1189334845 X:40164923-40164945 TCAGAGAAGGAGGAAATGGTGGG - Intronic
1189539687 X:41972709-41972731 CCTGAGGAGGGGGTGCTGGCTGG + Intergenic
1189620618 X:42833435-42833457 CCTTAGAAGGTGGAACTGCATGG - Intergenic
1189795678 X:44644098-44644120 CCTGAGCAGGACGATCTGGGTGG + Intergenic
1190335484 X:49259224-49259246 CCTGAGATGGGGGACATGGCGGG + Intronic
1190520311 X:51272592-51272614 TCTGAGAAGGGGGTACTGACTGG - Intergenic
1190569994 X:51770935-51770957 CTTTAAAAGGAGGAACTGGCTGG - Intergenic
1190598051 X:52066147-52066169 CTGGAGAAGGAGGAACATGCGGG + Intronic
1190610773 X:52187926-52187948 CTGGAGAAGGAGGAACATGCGGG - Intronic
1190798025 X:53761778-53761800 CATGATAAGCAGGAACTAGCTGG + Intergenic
1191922371 X:66270574-66270596 CCTAAGAAGGAGGTCCTGGGAGG + Intergenic
1192203681 X:69082616-69082638 TCTGAGGAGCAGGACCTGGCAGG - Intergenic
1193102282 X:77627756-77627778 CCTCAGAAGGCTGAACTGGGAGG + Intronic
1193547428 X:82846921-82846943 CCAGAGCAGGAGGAAGTGGGAGG - Intergenic
1194095225 X:89631678-89631700 CCAAATAAGAAGGAACTGGCAGG - Intergenic
1194215312 X:91123930-91123952 CCTGAGGTGGACCAACTGGCAGG - Intergenic
1194665649 X:96674764-96674786 CCAGAGAGGGAGGACCTGGAAGG - Intergenic
1195513468 X:105744731-105744753 CCTGAGAATAAGGAAGTGGTAGG - Intronic
1195650443 X:107278069-107278091 CCAGAGCAGGAGGAAGTGGGGGG - Intergenic
1199535366 X:148896517-148896539 ACTGAGAAGGAGAATCTTGCTGG - Intronic
1200447859 Y:3287856-3287878 CCAAATAAGAAGGAACTGGCAGG - Intergenic
1200970830 Y:9150738-9150760 TTTGAGAAGGTGGAACTAGCTGG - Intergenic
1201161892 Y:11173102-11173124 CCTGAGAAGGAGGGCCTGTCTGG - Intergenic
1202140200 Y:21713575-21713597 TTTGAGAAGGTGGAACTAGCTGG + Intergenic