ID: 950598566

View in Genome Browser
Species Human (GRCh38)
Location 3:14009277-14009299
Sequence CTGTAATAGGAGATGGAACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 449
Summary {0: 1, 1: 4, 2: 33, 3: 117, 4: 294}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950598566_950598569 -2 Left 950598566 3:14009277-14009299 CCGTGTTCCATCTCCTATTACAG 0: 1
1: 4
2: 33
3: 117
4: 294
Right 950598569 3:14009298-14009320 AGTTCCTCAAAGACGTGCTCAGG 0: 1
1: 0
2: 1
3: 11
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950598566 Original CRISPR CTGTAATAGGAGATGGAACA CGG (reversed) Intronic
900432372 1:2608383-2608405 CTTTAATAGGAACTGAAACATGG + Intronic
901540353 1:9911103-9911125 CTGTATTTGGAGAGGGTACAGGG + Intergenic
904443528 1:30549627-30549649 CTGTAATGGGAGATTGCACGGGG - Intergenic
904698930 1:32346813-32346835 CTGAACTAGGCGAGGGAACAGGG + Intergenic
904875110 1:33648438-33648460 CAAGAACAGGAGATGGAACATGG + Intronic
905472037 1:38200199-38200221 TTGTAACAGGAGATGAAACATGG + Intergenic
905573269 1:39023259-39023281 TTGTAATAGGAGATGAAACATGG + Intergenic
906016232 1:42582809-42582831 TTGTAACAGGAGAAGAAACATGG - Intronic
906484254 1:46222123-46222145 CTGGAAAAGGAGAGGGAGCAAGG + Intergenic
906799338 1:48722238-48722260 CAGTAAGATGAAATGGAACAGGG + Intronic
907369270 1:53989606-53989628 CTGTAAGAAGAAATGAAACATGG + Intergenic
907690802 1:56663493-56663515 TTGTAATAGGAAATGAAACATGG - Intronic
907727269 1:57031354-57031376 CAGTATTATCAGATGGAACATGG - Intronic
907966901 1:59340470-59340492 CTTTGAAAGGAAATGGAACATGG + Intronic
908072738 1:60481280-60481302 CTGTAACAGAAGATGAAACATGG - Intergenic
908311021 1:62883875-62883897 CTGTAAGAGTTGATGAAACAGGG + Intergenic
908887183 1:68802882-68802904 TTGTAACAGAAGATGAAACATGG + Intergenic
909198880 1:72663313-72663335 TTGTAACAGAAGATGAAACACGG + Intergenic
909735262 1:78951161-78951183 CTGTAAGCTGAGATGGAACCTGG - Intronic
911550764 1:99277218-99277240 CTGTAACAAGTGATGAAACATGG - Intronic
912577812 1:110691035-110691057 CTGTAACAGGAGATGAAACATGG + Intergenic
913529423 1:119723044-119723066 CTGAAATAGGAGAAAGAAAAGGG + Intronic
913556292 1:119970508-119970530 ATGTACTAGGAGATGGAAAAAGG + Intronic
913676328 1:121144331-121144353 TTGTAATGGGAGATGAAACATGG + Intergenic
914028223 1:143932281-143932303 TTGTAATGGGAGATGAAACATGG + Intergenic
914995622 1:152541104-152541126 TTGTATTGGGAGATGGAAAAGGG - Intronic
915002912 1:152609777-152609799 TTGTATTGGGAGATGGAAAAGGG + Intergenic
916455216 1:164964113-164964135 TTGTAATAGTAGATGAAACATGG + Intergenic
918188459 1:182148444-182148466 CAGTAATAGGAGAAGGAAGTAGG - Intergenic
918442356 1:184580252-184580274 TTGTAACAGGAGATGAAACGTGG - Intronic
919627797 1:199929113-199929135 TAGTAACAGGAGATGAAACATGG - Intergenic
920372288 1:205486737-205486759 CTGGAAGAAGAAATGGAACAAGG - Intergenic
920463694 1:206163172-206163194 TTGTAATGGGAGATGAAACATGG + Intergenic
921008059 1:211113551-211113573 ATGGAAGAGGAGAAGGAACAGGG + Intronic
921257332 1:213354499-213354521 CTGTTATAAGAAATGGAAAATGG - Intergenic
921511570 1:216037530-216037552 TTGTAATAGGAGTTGAAATATGG - Intronic
921804229 1:219436013-219436035 TTGTAATAGGAGATGGCACTGGG - Intergenic
921879846 1:220243572-220243594 CTGAAAAAGTAGATGGAAGATGG - Intronic
922030894 1:221796779-221796801 TTGTAACTGGAGATAGAACATGG - Intergenic
923059184 1:230454948-230454970 CTTTCAAAGGAGATGGAAAAAGG - Intergenic
924049144 1:240062791-240062813 TTGTAACAGGAGATGAAACACGG - Intronic
924388092 1:243519379-243519401 TTGTAACAGGAGATGAAACATGG + Intronic
1063132507 10:3190328-3190350 CTGTATCAGCAGATGGAACGTGG + Intergenic
1063814770 10:9759278-9759300 CTGTAATAGGAGATAGGATGGGG - Intergenic
1063875159 10:10468413-10468435 TTGTAACAGGAGATGGAACATGG - Intergenic
1064786693 10:18905573-18905595 ATGTAACAGGAGATGAAACATGG + Intergenic
1067141191 10:43658606-43658628 CTGTAAGAGAACATGAAACACGG - Intergenic
1067882749 10:50060870-50060892 CCTCACTAGGAGATGGAACAAGG - Intergenic
1068421715 10:56802736-56802758 TTGTAACAGGAGATGAAACATGG - Intergenic
1068507495 10:57920844-57920866 TTGTAACAGGAAATGAAACATGG - Intergenic
1068509296 10:57943987-57944009 CTATAATAGCGGATGGAAAATGG - Intergenic
1068562637 10:58532868-58532890 TTGTAACAGCAGATGAAACATGG + Intronic
1069270561 10:66521833-66521855 TTGTAACAGGAGATGAAACACGG - Intronic
1069322073 10:67184346-67184368 ATGTAAAAGGAGATGGAACATGG - Intronic
1070716786 10:78728291-78728313 CTATAATAGGCGATGGGACCAGG - Intergenic
1070931311 10:80262860-80262882 TTGTAACAGGAGATGGAACTTGG - Intergenic
1072046506 10:91661725-91661747 TTGTAACAGGAGATGAAATATGG - Intergenic
1073110722 10:101061679-101061701 CTGTAAAATCAGATGGGACAGGG + Intergenic
1074180395 10:111057772-111057794 TTGGAACAGGAGATGAAACATGG + Intergenic
1075550988 10:123392079-123392101 CTATACTAGAAGATGGAAGAAGG - Intergenic
1076232063 10:128828786-128828808 TTGTAACAGGAGATGAAACATGG + Intergenic
1078299943 11:10118651-10118673 CTAAAATTGGAGATGGAAAATGG - Intronic
1078741574 11:14071568-14071590 ATGTTCTAGGAGAAGGAACAGGG - Intronic
1078842747 11:15093833-15093855 TTGTAACAGGAGATGAAACATGG - Intergenic
1080327961 11:31100059-31100081 CTGTGCTAGGATATGGCACAAGG + Intronic
1080753447 11:35172258-35172280 TTATAACAGGAGATGAAACATGG - Intronic
1080981122 11:37407508-37407530 CTGTAATAGAAGATGAAACATGG + Intergenic
1081011958 11:37824467-37824489 CTGTAAGGGGAAATGGAACACGG + Intergenic
1081067409 11:38562724-38562746 TTGTAACAGGAAATGAAACATGG + Intergenic
1082679231 11:56148234-56148256 TTGTAACAGGAGATACAACATGG - Intergenic
1082948371 11:58785271-58785293 CTGTAATAGAAGATGAAACATGG - Intergenic
1083497661 11:63072306-63072328 TTGTAGCAGGAGATGAAACATGG - Intergenic
1085661525 11:78371873-78371895 TTGTAATAAGAGATGGAACTGGG - Intronic
1085678485 11:78548257-78548279 GTTTAACAGGAGTTGGAACAAGG + Intronic
1086729763 11:90233971-90233993 GTGTAATCAGAGAAGGAACAGGG + Intergenic
1086734857 11:90293856-90293878 TCGTAACAGGAGATGAAACACGG - Intergenic
1087121404 11:94578202-94578224 TTGTAAGAGGAGATGAAACCTGG - Intronic
1087489411 11:98804390-98804412 CTGTAACAAGAGATAAAACATGG - Intergenic
1089435754 11:118464691-118464713 TTGTAACAGGAGATGAAACATGG + Intronic
1090841885 11:130497261-130497283 TTGTAACAGGACATGAAACATGG - Intergenic
1091177230 11:133572013-133572035 TTTTAACAGGAGATGAAACATGG - Intergenic
1091853066 12:3716305-3716327 CTGTAACAGGGGATGAAACAGGG - Intronic
1092902560 12:13073567-13073589 CTGTAGCAGGAGATGAAACATGG - Intronic
1093128039 12:15353867-15353889 TTGTAACCGGAGATGAAACATGG - Intronic
1093857376 12:24122219-24122241 TTGTAACAGGAGATGAAACGTGG + Intergenic
1094018879 12:25893261-25893283 TTGTAACAGGGGATGAAACATGG + Intergenic
1094662044 12:32479289-32479311 ATTTAATAGGAAATGAAACAAGG - Intronic
1094675329 12:32614294-32614316 TTGTAACAGGAGATGAAACATGG + Intronic
1095357739 12:41296237-41296259 CTGTAACAGGAAATGAAACATGG + Intronic
1097412713 12:59274830-59274852 ATGTAACAGGAGATGAAACATGG - Intergenic
1097498181 12:60369591-60369613 TTGTAACAGGAGATAAAACATGG - Intergenic
1097901292 12:64875938-64875960 TTATAATAGGAGTTAGAACAGGG + Intronic
1098172219 12:67758486-67758508 CTGTTATAAGCAATGGAACATGG + Intergenic
1098305819 12:69101633-69101655 CTGTAACGTGAGATGAAACATGG + Intergenic
1098466524 12:70793349-70793371 TTGTAACAGGAGATTAAACATGG + Intronic
1098864163 12:75743236-75743258 TTGTAACAGGAGATGAAACAAGG + Intergenic
1099939793 12:89172474-89172496 TTGTAACAGAAGATGAAACATGG - Intergenic
1100282707 12:93133441-93133463 TTGTAATAGGAGATGAAACACGG + Intergenic
1100908161 12:99325722-99325744 TTGTAATAGGAGATGGAGCATGG + Intronic
1102028336 12:109726200-109726222 CTATTCTAGGAGAGGGAACAGGG - Intronic
1102145792 12:110654309-110654331 CTGGCATAGGAGATGTCACAGGG + Intronic
1102754876 12:115330725-115330747 TTGTAACAGGAGATGAAACATGG + Intergenic
1103492025 12:121328912-121328934 ATGTAATAGGAGATCAAAAAAGG + Intronic
1103620816 12:122186140-122186162 CTGTAGCAGGAGAGGGAGCACGG - Intronic
1104084991 12:125466257-125466279 GTCAGATAGGAGATGGAACAAGG + Intronic
1104279578 12:127362563-127362585 TTGTGACAGGAGATGAAACATGG - Intergenic
1104787991 12:131462292-131462314 TTGTAACAGGAGATGAAACATGG - Intergenic
1105601171 13:21888760-21888782 CTGTAGAAGGAGTTGGATCAAGG + Intergenic
1106697226 13:32188759-32188781 TTGTAACAGGAGATATAACATGG - Intronic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1106757214 13:32834868-32834890 TTGTAATAGGAGATGGAACATGG + Intergenic
1106935992 13:34720598-34720620 ATGTAACAGGAGATGGAACATGG - Intergenic
1107118303 13:36770825-36770847 TTGTAAGAGGAAATGGAACATGG - Intergenic
1108206857 13:48098765-48098787 CTGTAACAGGAGATGAAAAATGG - Intergenic
1108215802 13:48183177-48183199 CTGTAACAAGAGATGAAACATGG + Intergenic
1108367291 13:49728560-49728582 TTGTAAAAGGAGATGAAACATGG + Intronic
1108897611 13:55353404-55353426 TTGTAACAGCAGATGAAACATGG + Intergenic
1109576467 13:64265139-64265161 TTGTAACAGGAGATGAAACATGG + Intergenic
1109888371 13:68574127-68574149 CTGTAACAGGAGTTGAAACATGG + Intergenic
1109947494 13:69456256-69456278 TTGTAACAGGAGATGAAACCCGG - Intergenic
1110003766 13:70238973-70238995 CTGTCATAGGACTTGCAACAGGG - Intergenic
1111002147 13:82198330-82198352 TTGTAATAGAAGATGGAGGATGG + Intergenic
1112780253 13:102892650-102892672 TTGAAATTGGAGCTGGAACAGGG + Intergenic
1112949994 13:104982246-104982268 TTGTAACAGGAGATGAAATACGG - Intergenic
1113044208 13:106137134-106137156 CTGTAACAGAAGATGAAACATGG - Intergenic
1113184066 13:107666389-107666411 TTGTCACAGGAGATGAAACATGG - Intronic
1113198655 13:107839216-107839238 CTGGAATAGGAGCAGGAAGATGG - Intronic
1114353097 14:21876159-21876181 TTGGAACAGGAGATGAAACATGG + Intergenic
1114581647 14:23766011-23766033 TTGTAACAGGAGATGAAGCATGG + Intergenic
1114626070 14:24131267-24131289 CTGTCACAGGAACTGGAACATGG + Exonic
1114676704 14:24445457-24445479 TTGTAACAGGAGATGAAATATGG + Intergenic
1114753881 14:25236551-25236573 TTGTAACAAGAGATGAAACATGG + Intergenic
1114942243 14:27627528-27627550 TTGTAACAAAAGATGGAACATGG - Intergenic
1115108051 14:29784999-29785021 CAGTAAAAGGAGATGGAATTTGG - Intronic
1115112308 14:29839338-29839360 TTGTAATAGGAGATGAATCATGG + Intronic
1116268070 14:42721429-42721451 TTGTAACAGGATATGAAACAAGG - Intergenic
1116426894 14:44801455-44801477 CTGTAATGGTAGATGAAACATGG + Intergenic
1116943491 14:50813642-50813664 CTGTAACAGGAAGTGGAATAAGG + Intronic
1117031154 14:51672066-51672088 TTGTAACAAGAGATGAAACATGG + Intronic
1117228376 14:53687609-53687631 CTGAAATGGAAGATGAAACAAGG - Intergenic
1117386537 14:55219686-55219708 TTGTAACAGGAGATGAAACATGG + Intergenic
1117467788 14:56011091-56011113 TTGTAATAGGAGATGAAACATGG + Intergenic
1117689185 14:58287861-58287883 TTGTAACAAGAGATAGAACATGG - Intronic
1118467891 14:66047550-66047572 TTGTAACAGGAGATGAAACATGG - Intergenic
1118830681 14:69428665-69428687 TTGTAACAGAAGATGAAACATGG + Intronic
1119573029 14:75693119-75693141 CTGAAAGAGGAGAAGGAAGAAGG + Intronic
1119965353 14:78909200-78909222 TTGTGACAGGAGATGAAACATGG + Intronic
1119987813 14:79159272-79159294 TTGTAACAGGAGATGAAACATGG - Intronic
1120223320 14:81760384-81760406 TTGTTATAGGAGTTGAAACATGG + Intergenic
1120382896 14:83805168-83805190 GAGTAATAGGAGATGGCAAAAGG - Intergenic
1124338324 15:28873722-28873744 CTGGAATGGGAGGAGGAACATGG - Intergenic
1126103077 15:45131013-45131035 ATTTAATAGGAGATGGAGTAGGG + Intronic
1127566499 15:60194280-60194302 CAGGAAGAGGAGAGGGAACAGGG - Intergenic
1127653948 15:61037793-61037815 CTATAATAGAAGATGGAAGAAGG + Intronic
1129223173 15:74146582-74146604 TTGCAACAGGAGATGAAACATGG + Intergenic
1129558686 15:76541788-76541810 CTGTAATAGGAAAAGGGCCATGG - Intronic
1130127881 15:81109324-81109346 CTGCAACAGGAGATGAAATATGG - Intronic
1131430217 15:92381554-92381576 TTGTAGCAGGAGTTGGAACATGG - Intergenic
1131618818 15:94045371-94045393 CTGTAGCAGGAGATGGAACATGG - Intergenic
1132438363 15:101832526-101832548 TTGTAATAGGACATGAAGCATGG + Intergenic
1134788377 16:16965328-16965350 GTGTAATAGGTCATGGAATATGG + Intergenic
1136461909 16:30416751-30416773 CTGTAAGAGGAGATGTCAGAGGG - Intronic
1138613968 16:58149754-58149776 CTGTAACAGGAGATGACACATGG + Intergenic
1138772241 16:59679753-59679775 TTGTTTTAGGAGTTGGAACAAGG + Intergenic
1139197270 16:64934069-64934091 CTGTCAGAGGAGATGGAATGAGG + Intergenic
1140150133 16:72354674-72354696 TTGTACTACGAGATGGAACAAGG - Intergenic
1140379292 16:74471784-74471806 TTTTAAGAAGAGATGGAACAGGG - Intronic
1140418379 16:74794534-74794556 CTACAATGGGAAATGGAACAGGG - Intergenic
1141024008 16:80526839-80526861 CTGGCATAGGAGATGAAACTGGG + Intergenic
1146210759 17:30941022-30941044 CTGTAACAGGAGATGAAACATGG - Intronic
1147031182 17:37638032-37638054 CTGTAACAGAAGATGAAACATGG + Intronic
1147274096 17:39300470-39300492 CTATACTAGGAGATAAAACATGG + Intronic
1148516857 17:48227163-48227185 CTGTGAATGGAGAGGGAACATGG + Intronic
1149195329 17:54112743-54112765 TTGTAAAAGGAGATGAAACATGG + Intergenic
1149307272 17:55360248-55360270 CTGTAAAAGGAGATAAAACATGG - Intergenic
1149617569 17:58014158-58014180 TTGTAACAGGACATGAAACATGG + Intergenic
1150981130 17:70142760-70142782 CTGTTATAGCAGACTGAACAGGG + Intergenic
1151016032 17:70553964-70553986 TTGTAACAGGAGAGGAAACATGG - Intergenic
1151106520 17:71622399-71622421 CTGTGACAGGAGATGGAAACTGG - Intergenic
1152205016 17:78970008-78970030 CTGGAACAGGAGGTGGCACAGGG - Intergenic
1153771505 18:8420602-8420624 CTGTAAAAGGAGAAGAGACACGG - Intergenic
1155266271 18:24097371-24097393 CTGTAATAGGAGATGAAATGTGG - Intronic
1155601628 18:27555542-27555564 TTGTAATAGGAGATGAAACATGG + Intergenic
1155854790 18:30819730-30819752 TTGTAGCAGGAGATGAAACATGG + Intergenic
1156074393 18:33255749-33255771 CTGGGACAGGAGATGGAGCAAGG + Intronic
1156255273 18:35389383-35389405 TTGTAACAGGAGATGAAACACGG + Intergenic
1156592397 18:38505848-38505870 TTGTAACAGGAGATGAAACATGG - Intergenic
1157651243 18:49334082-49334104 ATTTAATAGGAGATGGAAACTGG - Intronic
1157768443 18:50323437-50323459 TTGTAACAGGAGATGAAACATGG + Intergenic
1158763619 18:60421352-60421374 TTGTAACAGAAGATGAAACACGG + Intergenic
1159148039 18:64480541-64480563 TTATAACAGGAGATGGAATACGG - Intergenic
1159158180 18:64609447-64609469 TCATAACAGGAGATGGAACATGG - Intergenic
1159854503 18:73568100-73568122 CTGCAATAGGAGATTGATGATGG - Intergenic
1160344311 18:78120208-78120230 CTGTGATATGAGAAGGAATAAGG + Intergenic
1166830802 19:45638679-45638701 CTGGAAGAGGAGAGGGAATAGGG - Intronic
1168476094 19:56676406-56676428 CTGTACTTGGAGATGGAGAAAGG - Intergenic
926069723 2:9877330-9877352 CTGGAAAAGGAGCTGGATCAAGG - Intronic
926410791 2:12600451-12600473 CTGTAACAGGAGATGAAACATGG + Intergenic
926937756 2:18103405-18103427 CTGGTAGAGGAGCTGGAACATGG + Intronic
926953921 2:18272485-18272507 CTGTAACAAGAAATGAAACATGG + Intronic
926962497 2:18373813-18373835 CTGTAACAGGAGAAGAAACATGG + Intergenic
927120870 2:19961558-19961580 TTGCAAAAGGAGATGAAACATGG + Intronic
928321616 2:30287915-30287937 CTGAAAATGGAGATGGAAGATGG - Intronic
928728066 2:34198565-34198587 CTGTAACAGGAGATGAAACATGG + Intergenic
928972328 2:37043223-37043245 CTGTAACAGGAGATGGAACATGG + Intronic
929389350 2:41451311-41451333 TTGTAAAAGAAGATGAAACATGG + Intergenic
931312759 2:61097978-61098000 CTCTAAGAAGAGATGGAAAATGG - Intronic
931613536 2:64130556-64130578 CTTTAATAGAAGATAGCACAGGG - Intronic
932095377 2:68843097-68843119 TTGTAACAGTAGATGAAACATGG - Intergenic
933466917 2:82663516-82663538 TTGTAACAGAAGATGAAACAGGG - Intergenic
933643503 2:84789458-84789480 TTATAACAGGAGATGGAACATGG + Intronic
935281747 2:101523825-101523847 TTGTAACAGGAGATGGAACGTGG - Intergenic
935286863 2:101572704-101572726 CTATAGCAGGAGATGGAACATGG + Intergenic
935801884 2:106705909-106705931 TTGTAACAGGAGATGGAACATGG - Intergenic
939063867 2:137458436-137458458 TTGTAACAGGAGATGAAACATGG - Intronic
939304513 2:140393580-140393602 CTGAAATAGAAGATGGAAAATGG - Intronic
939857953 2:147383139-147383161 CTGAAATGGGAGAGGGAAGAAGG - Intergenic
939984811 2:148819312-148819334 TTGTAACAGGAGATGAAACGTGG + Intergenic
941004518 2:160234365-160234387 ATGTAATGGGAGATGAAACACGG + Intronic
941238418 2:163005673-163005695 TTGTAACAGGAGATGAAATATGG - Intergenic
941318474 2:164024854-164024876 TTATAACAGGAAATGGAACATGG - Intergenic
941681632 2:168406070-168406092 TTGTAACAGGGAATGGAACATGG + Intergenic
941759663 2:169227927-169227949 CAGTAATAGGAGATGGACCCTGG + Intronic
943056701 2:182990717-182990739 CTATAATAGGAGTTTAAACATGG - Intronic
943293554 2:186107756-186107778 CTGCAAGAGGAGATAAAACATGG + Intergenic
943633053 2:190276018-190276040 CTGTAACAGGAGATGAAACATGG + Intronic
943667921 2:190629904-190629926 CTGTAACAGGAAATAAAACATGG + Intergenic
945208198 2:207354858-207354880 CTGTACCAGGAGAAGAAACATGG - Intergenic
946151567 2:217776397-217776419 TTGTAACAGGAGATGAAACAGGG - Intergenic
947032250 2:225809949-225809971 TTGTAACAGGAGATGGAACGTGG - Intergenic
947246659 2:228055998-228056020 CTGTCATTGAAGATGGAGCAAGG - Intronic
948458256 2:238117228-238117250 CTGTAACAGGAGCTGTGACAGGG + Intronic
948855293 2:240727486-240727508 TTGTCAGAGGAGATGGACCATGG - Intronic
1169138749 20:3214242-3214264 CTGTAAGTGGAGATGGTAAAGGG + Intronic
1170174720 20:13456052-13456074 CTATAACAGCAGATGAAACATGG + Intronic
1171403558 20:24894381-24894403 CTGTAATGGGAGTTGTTACATGG + Intergenic
1173239925 20:41285534-41285556 CTGTAATAGTAAATGCAGCAAGG + Intronic
1173905024 20:46620928-46620950 TTGTAACAGGAGATGAAACATGG + Intronic
1175530364 20:59670758-59670780 GTGCAGTAGAAGATGGAACATGG - Intronic
1177220259 21:18183253-18183275 TTCTAATAGGAGATTGAACCAGG + Intronic
1177994869 21:28084520-28084542 TTGTAACAGGAGATGAAACATGG - Intergenic
1178145204 21:29731449-29731471 ATTTAATAGGAGATGAAACATGG - Intronic
1178599492 21:33983801-33983823 ATGTAAGAGGAGAGGGAACAGGG - Intergenic
1178789438 21:35686273-35686295 CTGTAACAGAAGATGAAACATGG + Intronic
1183798183 22:40138221-40138243 GTGAAATAGGAGATAGAGCAAGG + Intronic
1184051171 22:42005816-42005838 TTGTAACAGGAAATGAAACATGG + Intronic
1185100612 22:48839034-48839056 CTGTGCTAGGAGATGACACAAGG - Intronic
949434558 3:4014318-4014340 TTGTAACAGAAAATGGAACATGG - Intronic
949881236 3:8662579-8662601 ATGAAAAAGGAGAAGGAACAAGG + Intronic
950598566 3:14009277-14009299 CTGTAATAGGAGATGGAACACGG - Intronic
952366551 3:32679866-32679888 TTGTAACAGAAGATGAAACATGG - Intergenic
952732093 3:36649373-36649395 CTGTAATAACAGATGGAATGAGG - Intergenic
952760460 3:36908997-36909019 CTCTCTTAGCAGATGGAACAGGG + Intronic
953224536 3:41005067-41005089 TTGTAACAGGAGATGAAATATGG + Intergenic
953465985 3:43119948-43119970 CTGGAATTGGAGAAGGAGCATGG - Intergenic
953771761 3:45782909-45782931 CTGAAATAGAAGATGGAATGTGG - Intronic
953812390 3:46124533-46124555 GTGTAAGAGGAGATGGAACATGG - Intergenic
954052617 3:47993649-47993671 TTGTAACAGGAGATGAAATATGG + Intronic
955578455 3:60392699-60392721 TTATAACAGGAGATGGAACCTGG + Intronic
956091285 3:65669643-65669665 TTGTAACAGGAAATGAAACATGG - Intronic
956274607 3:67484470-67484492 CTGTAATGGTACATAGAACATGG - Intronic
957561688 3:81830227-81830249 ATGGAATTGGAAATGGAACATGG + Intergenic
957762854 3:84581910-84581932 ATGTAACAAGAGATGAAACATGG + Intergenic
958724837 3:97892084-97892106 TTATAACAGGAGATGAAACATGG - Intronic
958899291 3:99866795-99866817 CTGTAATTAGAGATGGCATATGG - Intronic
959007106 3:101032306-101032328 TTGTAATAGGAGATGAAACATGG + Intergenic
959669530 3:108960409-108960431 CTGTAACAGGAGATGAAACATGG + Intronic
959921617 3:111874508-111874530 CTGAATGAGGACATGGAACAAGG - Intronic
962646185 3:137443014-137443036 TTGTAACAAGAGATGAAACATGG - Intergenic
964863765 3:161231112-161231134 GTGAAATAAGAGAGGGAACAAGG + Intronic
966104821 3:176323228-176323250 GTAGAATAGCAGATGGAACACGG + Intergenic
966954378 3:184858899-184858921 CTGTAACAGGAGATAAAACATGG - Intronic
967517301 3:190385377-190385399 ATGTAATAGGAGATACAAAAAGG - Intronic
968324301 3:197799151-197799173 CTGTAAAAGGAACTGGAACCTGG - Intronic
968550018 4:1217301-1217323 CTGTTCTACGAGAAGGAACATGG + Intronic
969389892 4:6884726-6884748 CTGTAACAGGAGATGGAACATGG - Intergenic
970628252 4:17913367-17913389 TTGTAAAAGGTGATGAAACACGG + Intronic
970938435 4:21602237-21602259 CTGTAATGAGACATGGAGCAAGG - Intronic
970982514 4:22117253-22117275 CTGTAATAGCAGAGGGGAAAAGG + Intergenic
972518772 4:39834002-39834024 CTGCAATAGGAACTGAAACATGG + Intronic
974385062 4:61193576-61193598 TTTTAATAATAGATGGAACATGG - Intergenic
974694768 4:65352015-65352037 CTGTAACAGCAGATGGGAGACGG + Intronic
975103067 4:70536312-70536334 TTGGAACAGGAGATGGAACATGG - Intergenic
975206847 4:71654008-71654030 TTGTAGCAGGAAATGGAACATGG - Intergenic
975285236 4:72609642-72609664 CTATTACAGGAGATGAAACATGG + Intergenic
976235698 4:82894308-82894330 TTGTAACAGGAGATGAAACATGG - Intronic
976283581 4:83348999-83349021 TTGTAACAGGACATGGAACACGG + Intergenic
976528589 4:86122479-86122501 TTGTAACAGGAGATGAAACATGG - Intronic
976836281 4:89378203-89378225 TTGTAACAGGAGATGAAATATGG + Intergenic
977587451 4:98789552-98789574 GTGTAACAGGAGATGCAACACGG + Intergenic
977732970 4:100377684-100377706 TTATAACAGGAGATGAAACATGG + Intergenic
977932633 4:102765154-102765176 GCGTATTAGTAGATGGAACACGG + Intergenic
978393975 4:108258386-108258408 ATGTATTGGGAGATGGAATATGG - Intergenic
978490923 4:109311171-109311193 CTGTAACAGGAGATGAAACATGG + Intergenic
979191504 4:117864844-117864866 TTGTAACAGTAGATGAAACATGG + Intergenic
979359892 4:119749203-119749225 CTGTAACAGGAGATGAAACATGG - Intergenic
979764694 4:124449660-124449682 CTGTACTAGTACATTGAACATGG - Intergenic
979894635 4:126144889-126144911 CTATGAGATGAGATGGAACAGGG - Intergenic
980218788 4:129886756-129886778 CTATAATAGAAGATGAAACATGG + Intergenic
980651660 4:135724887-135724909 TTGTAACAGGAGATGAAAGATGG - Intergenic
981340084 4:143611531-143611553 CAGAAATATGAGAAGGAACAGGG + Intronic
981773012 4:148331808-148331830 CAGTAATAAGAGATGGTACTTGG - Intronic
981854793 4:149275566-149275588 CAGTAACAGAAGATGAAACATGG - Intergenic
981910612 4:149977139-149977161 TTGTAACAGGAGATGAACCATGG - Intergenic
982634556 4:157877302-157877324 CAATAATAGGAAATGGAAAAAGG - Intergenic
984421530 4:179528521-179528543 TTATAACAGGAGATGAAACATGG - Intergenic
984891652 4:184499256-184499278 TTGTAACAGGAGAGGAAACATGG + Intergenic
985297661 4:188453050-188453072 CTGTATTAGGAGATTGAATTGGG + Intergenic
987098147 5:14567924-14567946 CTGTAAGAAGACATGGAACTAGG + Intergenic
988400136 5:30751608-30751630 CTGTATTACTAGATGAAACAGGG - Intergenic
988557043 5:32246030-32246052 TTGTAACAGGAGAAGAAACATGG - Intronic
988729451 5:33956318-33956340 TTGTAACAGGAGATGAAACATGG + Intronic
990659082 5:57992627-57992649 TTGTAACAGGAGATGCAACACGG - Intergenic
991999576 5:72422555-72422577 CTGTAACAGAAAATGAAACATGG - Intergenic
992475221 5:77095401-77095423 TTGGAACAGGAGATGAAACATGG - Intergenic
993011220 5:82485198-82485220 TTGTAACAGGAGATAAAACATGG + Intergenic
994384803 5:99118605-99118627 TTGTAATAGGAAAAGGAACATGG + Intergenic
995415132 5:111902460-111902482 TTGTAACAGGAGATGAAACGTGG + Intronic
996362197 5:122662086-122662108 TTGTAACAGCAGATGGAACATGG + Intergenic
996475992 5:123921279-123921301 TTGTAACAGGAGATGGAATGTGG + Intergenic
996599023 5:125239758-125239780 TTGTAACAGAAGATGGAACGTGG - Intergenic
998146264 5:139730575-139730597 TTGAAGTAGGAGATGGGACAGGG + Intergenic
998278094 5:140777637-140777659 TTGTAACGGGAGATGAAACATGG - Intergenic
998278273 5:140779760-140779782 CTGTAACAGGAGATGACACATGG + Intergenic
998789907 5:145755078-145755100 TTGTACAAGGAGATGAAACATGG + Intronic
998835510 5:146199488-146199510 TTGTAACAGGAGATGAAACACGG + Intergenic
998928361 5:147152900-147152922 TTGTACCAGGAGATGAAACATGG + Intergenic
999686512 5:154108046-154108068 CTTTGGCAGGAGATGGAACAGGG - Intronic
1000152747 5:158519294-158519316 CTGTTCCAGGAGAAGGAACAGGG + Intergenic
1000189935 5:158900432-158900454 CTGTCATCGGAGATGGAGGAGGG + Intronic
1000390441 5:160717848-160717870 GTCTACTAGGAGATGGAGCAGGG - Intronic
1000546457 5:162609706-162609728 ATGTATTAGGAGCTGGATCAAGG + Intergenic
1001203364 5:169739301-169739323 CTGTAATTGTAGAGGGAAAATGG + Intronic
1001423218 5:171602726-171602748 CTGTAACAAGAGATGGAACATGG - Intergenic
1001976536 5:176004565-176004587 ATGTAACCGGAGATGGAACATGG - Intronic
1002240892 5:177839207-177839229 ATGTAACCGGAGATGGAACGTGG + Intergenic
1005319327 6:24637065-24637087 TTGTAACAGAAGATGAAACATGG + Intronic
1005370366 6:25125813-25125835 CTGTAACAGAAGATTAAACATGG + Intergenic
1006529845 6:34642495-34642517 CTATAACAGGAGATGAAACACGG + Intronic
1006846631 6:37066635-37066657 CGGGAACAGGAGATGAAACAGGG + Intergenic
1007124217 6:39411305-39411327 CTGTAATAGGAGCTGGAACCAGG - Intronic
1009502997 6:64441446-64441468 TTGTAACAGGAGATGATACATGG + Intronic
1009961761 6:70531369-70531391 TTGTAAGAGGAAATGAAACATGG - Intronic
1010859200 6:80885216-80885238 TTTTCATAGGAGATGGAATAAGG + Intergenic
1011533235 6:88347797-88347819 TTGTAACAGGAGATGAAACATGG - Intergenic
1011930760 6:92709232-92709254 TTGTAACAGGAGATGAAACATGG + Intergenic
1011997357 6:93609344-93609366 CTGTAGTAGGATCTGGACCAAGG - Intergenic
1012216137 6:96586930-96586952 CTGTGATAAGAGATGAAACACGG + Intronic
1012339782 6:98105583-98105605 TTGCAACAGGAGATGAAACAGGG - Intergenic
1012714239 6:102648621-102648643 TTGGAAGAGAAGATGGAACAGGG + Intergenic
1012745195 6:103078107-103078129 CTGTCAAAGGAGATGGAAAATGG - Intergenic
1012943760 6:105444263-105444285 TTATAACAGGAGATGAAACACGG - Intergenic
1013468718 6:110441413-110441435 TTGTAACAGGAGATGAAACACGG + Intronic
1013540862 6:111107643-111107665 TTGTAATAGGAGAGGAAACATGG + Intronic
1014070184 6:117172688-117172710 TTGTAACAGGAGATAAAACATGG + Intergenic
1014820561 6:125984425-125984447 CTGCCCTAGAAGATGGAACATGG + Intergenic
1015145805 6:129985382-129985404 TTGTAATAGGAGATGAAATGTGG + Intergenic
1015419453 6:132989232-132989254 TTGTAACAGGAAATGAAACATGG + Intergenic
1015499373 6:133916357-133916379 CTGTACTAAGAGATGGCACTAGG - Intergenic
1016218510 6:141634513-141634535 TTGTAAAAGGAGATGAAACGTGG - Intergenic
1016395640 6:143620932-143620954 CTGTACTAGGATATGCAACCAGG + Intronic
1020957641 7:14761785-14761807 CTGTAATGGGAGAAAGAACCTGG + Intronic
1020960474 7:14796503-14796525 TTGTAATCAGAGATGAAACATGG + Intronic
1021987310 7:26109356-26109378 TTGTAATAGGAGATGAAACATGG + Intergenic
1023567833 7:41541055-41541077 CTGTAATATGAGTGGGAACTGGG + Intergenic
1026180757 7:68038038-68038060 TTGTAATAAGAGATGAAACACGG - Intergenic
1027376049 7:77550978-77551000 CTGTAATAGGAGATGAAACATGG - Intronic
1028509313 7:91605459-91605481 CTGTAACAGAAGATGAAGCATGG - Intergenic
1029923376 7:104290037-104290059 GTGTAAGAAGAGATGGAAAAGGG - Intergenic
1030010725 7:105164050-105164072 CTGTAACAGGACATAAAACATGG + Intronic
1031567222 7:123315179-123315201 TTGTAACAGGGGATGAAACATGG - Intergenic
1031769354 7:125823630-125823652 CTGTAGCAGGAGATAAAACATGG + Intergenic
1032310684 7:130783947-130783969 CTGAAATAGAAGATAGAAGATGG - Intergenic
1033214855 7:139485900-139485922 TTGTAACAGAAGATGGAACGTGG + Intergenic
1033287258 7:140052078-140052100 TTGTAACAGGAGATGGAACATGG - Intronic
1033428693 7:141268705-141268727 TTGTAACAGGAGATGGAACCTGG + Intronic
1033506407 7:142006611-142006633 TTGTAGCAGGTGATGGAACATGG - Intronic
1033706372 7:143889555-143889577 CTGTAACAGGAGAGGAAACATGG + Intronic
1036996247 8:13660348-13660370 CTGTAAGAGGAGATTGGACTAGG - Intergenic
1037104326 8:15086507-15086529 GTGGAAGAGAAGATGGAACAAGG - Intronic
1038271311 8:26078294-26078316 CTGTGACAGGAGGTGGGACAGGG - Intergenic
1038271327 8:26078357-26078379 CTGTGACAGGAGGTGGGACAGGG - Intergenic
1039402806 8:37285606-37285628 CTGTAACAGAAGATGAAACATGG + Intergenic
1039802520 8:40972101-40972123 CTGTAGCAGGAGATGAAACATGG + Intergenic
1041147766 8:54896033-54896055 TTGTAACAGAAGATGAAACATGG + Intergenic
1041309401 8:56499345-56499367 CCGTCACAGGAGATGAAACATGG - Intergenic
1041717637 8:60946437-60946459 CTGTAATACCAGATTGAACATGG + Intergenic
1041798101 8:61768507-61768529 TTGTAACAGAAGATGAAACACGG + Intergenic
1041913000 8:63109453-63109475 TTGTAACAGGAGGTGAAACATGG + Intergenic
1042622989 8:70726577-70726599 CTGTAACAGGAGATGAAACATGG + Intronic
1043137472 8:76546527-76546549 CTGTAAAAGGAGCAGGAACAGGG - Intergenic
1043579697 8:81697999-81698021 TTGTAACAGGAGATGAAACATGG + Intergenic
1043930786 8:86089233-86089255 TTGTAATAAGAGATGAAATAAGG + Intronic
1043953322 8:86334075-86334097 TTGTAACAGGAGATGAAACATGG - Intergenic
1044057868 8:87594865-87594887 TTGTAACAGGAGATGAAACACGG - Intronic
1044460341 8:92437174-92437196 ATGACATAGTAGATGGAACACGG - Intergenic
1044826225 8:96200090-96200112 TTGTAACAGGAGATGAAACATGG + Intergenic
1044889640 8:96819835-96819857 CTGTAACAGGAGATGAAACATGG - Intronic
1044926363 8:97212517-97212539 TTGTAATAGGAGATAAAACATGG - Intergenic
1045237609 8:100368221-100368243 TTGTAGCAAGAGATGGAACATGG + Intronic
1045413852 8:101947078-101947100 TTGTAACAGGAGATGGAACATGG + Intronic
1045895479 8:107210955-107210977 TTGTAACAGGAGATGGAACATGG + Intergenic
1045916701 8:107480819-107480841 TTGTAACAGGAGATAGAACATGG + Intronic
1046305850 8:112366039-112366061 CTATAACAGGAGATGAAACATGG + Intronic
1046789502 8:118305961-118305983 TTGTAGTAGGAGCTGGAACCAGG - Intronic
1048068232 8:130993945-130993967 CTGTAACAGGAGATGAAACCTGG - Intronic
1048077930 8:131093875-131093897 CTGTAGTAGGAGATGTGTCAGGG + Intergenic
1050673283 9:8022766-8022788 TTGTAACAGGAGATGAAACATGG + Intergenic
1051652175 9:19338859-19338881 GTGTAATAAGTGATGGAAAATGG + Intronic
1052519890 9:29533179-29533201 TTATAACAGGAGATGAAACATGG - Intergenic
1052654771 9:31343155-31343177 TTGTAACAGGAGGTGAAACATGG - Intergenic
1054866692 9:70010006-70010028 TTGTAACAGGAGATGAAACATGG + Intergenic
1055119725 9:72645376-72645398 CATTAATAGGAGATGAAACATGG + Intronic
1055151893 9:73010401-73010423 CAGAAATAAGAGAAGGAACATGG - Intronic
1055882070 9:81013696-81013718 GTAGAATAGCAGATGGAACACGG - Intergenic
1056301000 9:85241468-85241490 CTGCAATAGGGAATGAAACAAGG + Intergenic
1056329257 9:85508470-85508492 CTGAAATAACAGATGGAACAGGG + Intergenic
1056811476 9:89768387-89768409 TTGTAACAGGACATGAAACACGG + Intergenic
1058565165 9:106275841-106275863 TTGTAACAGGAGATGAAACATGG + Intergenic
1060209919 9:121703352-121703374 CTATAGTAGGGGAGGGAACAAGG - Intronic
1186457829 X:9724206-9724228 TTGTAACAGGAGATGAAGCATGG + Intergenic
1187503756 X:19862070-19862092 CTGTAACAGGAGATGAAACACGG - Intronic
1188153849 X:26716223-26716245 CTGTAACAGGAGATGAAACATGG - Intergenic
1188239794 X:27771856-27771878 CAGTGATAGGTTATGGAACAGGG + Intergenic
1188266029 X:28075891-28075913 TTGTAACAGGAGATGAAACATGG + Intergenic
1188913634 X:35882218-35882240 CTATTATAGGAGAAGAAACAAGG + Intergenic
1189011528 X:37049953-37049975 CTAAAATAATAGATGGAACAAGG + Intergenic
1189637021 X:43022279-43022301 TTGTAACAGGAGATGAAACATGG - Intergenic
1189660340 X:43290288-43290310 TTGTAACAGGAGATGAAACATGG - Intergenic
1189671588 X:43416025-43416047 CTGTAACAGGAAATGAAACATGG - Intergenic
1189684215 X:43546945-43546967 TTGTAACAGGAGATGAAACATGG - Intergenic
1189731519 X:44025812-44025834 CTGTAGTAGGAGATGAGTCATGG + Intergenic
1190034996 X:47014053-47014075 TTATAATAGGAGATGAAACATGG - Intronic
1190171003 X:48111627-48111649 CTGTAAATGGAGAAGGAGCAGGG + Intergenic
1190436007 X:50426186-50426208 CTGTAAAATGAGCTGGTACAGGG - Intronic
1191880879 X:65842881-65842903 TTGAAATAGGAGTCGGAACAAGG - Intergenic
1192531112 X:71886894-71886916 TTGTAACAGGTGATGAAACATGG + Intergenic
1194037295 X:88891893-88891915 TTGTAACAGGAGATGAAACATGG + Intergenic
1195897565 X:109762577-109762599 TTGTAACAGGAGATGAAACATGG - Intergenic
1196207171 X:112954075-112954097 ATGTAATAGGAGATGTAAAATGG - Intergenic
1196218465 X:113083546-113083568 TTGTAACAGGAGATGAAACAGGG + Intergenic
1196458525 X:115906540-115906562 CTTTAATAACAGATGGCACAGGG - Intergenic
1197282716 X:124556061-124556083 TTGTAATAGGAGATGAAATGTGG + Intronic
1197677657 X:129347413-129347435 CTGTAGTAGGGGATGCGACAGGG + Intergenic
1197992822 X:132336261-132336283 CTGTAACAGGAGATGAAACATGG + Intergenic
1198500564 X:137241621-137241643 TTGTAACAGGAGATGAAACATGG - Intergenic
1198504741 X:137290336-137290358 CTGTAAAAGGAAATGGAGGAGGG + Intergenic
1199905418 X:152223825-152223847 TTGTAATATGAGAAGCAACATGG - Intronic
1201724492 Y:17137864-17137886 GTAGAATAGCAGATGGAACATGG + Intergenic