ID: 950602270

View in Genome Browser
Species Human (GRCh38)
Location 3:14045381-14045403
Sequence TATGGTAATTAGAGGGATTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 3, 3: 12, 4: 137}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950602270_950602275 7 Left 950602270 3:14045381-14045403 CCCGAATCCCTCTAATTACCATA 0: 1
1: 0
2: 3
3: 12
4: 137
Right 950602275 3:14045411-14045433 GATCTCTCATATTTCCTTGATGG 0: 1
1: 1
2: 2
3: 18
4: 190
950602270_950602276 8 Left 950602270 3:14045381-14045403 CCCGAATCCCTCTAATTACCATA 0: 1
1: 0
2: 3
3: 12
4: 137
Right 950602276 3:14045412-14045434 ATCTCTCATATTTCCTTGATGGG 0: 1
1: 1
2: 2
3: 20
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950602270 Original CRISPR TATGGTAATTAGAGGGATTC GGG (reversed) Intronic
906431592 1:45759946-45759968 TATGATAATTAAAGGGATTTGGG - Intergenic
907145011 1:52223722-52223744 CATGATAATTAAAGGGATTTGGG - Intronic
907164573 1:52398888-52398910 TAGGGTTATTAGAAGGATTAAGG - Intronic
913315304 1:117545422-117545444 TTTGGTAATAGGAGGGAGTCAGG + Intergenic
917608556 1:176662134-176662156 CTTGGGAATTAGAGGAATTCAGG + Intronic
917988237 1:180344199-180344221 AATGGTAATTAGAAGGAATGGGG + Intronic
923932331 1:238716014-238716036 TATGGTAATTAGAAATATTCGGG - Intergenic
1063065431 10:2603244-2603266 TACGGTAAATAGAGGGTTCCTGG + Intergenic
1069097611 10:64278570-64278592 TATGTTAATTAGCTTGATTCTGG - Intergenic
1070994297 10:80762447-80762469 TATGTCATTTAAAGGGATTCAGG - Intergenic
1072218909 10:93310967-93310989 TATTGTTATTAGTGGTATTCAGG - Intronic
1078733719 11:14000615-14000637 TATGGTATTGATAAGGATTCTGG + Intronic
1079298344 11:19254793-19254815 TATGGGAATTATAGGAATTGTGG + Intergenic
1079556599 11:21765966-21765988 TTTGGTATTTACAGGGATCCTGG - Intergenic
1080614276 11:33932640-33932662 GATGGTAAGAAGTGGGATTCAGG - Intergenic
1081837319 11:46166609-46166631 AATGGTAATGAGAGGGATCACGG + Intergenic
1083109893 11:60395820-60395842 TATGTTAATTAGCTGGATTGTGG + Intronic
1086068128 11:82768218-82768240 TATGGTAATTAGAAGGTTTGGGG + Intergenic
1087365485 11:97213313-97213335 TATGTTAATTAGATTGATTGTGG + Intergenic
1087688651 11:101294300-101294322 TTTGGTATTTAGAGTGATACTGG + Intergenic
1088003686 11:104914456-104914478 TATGCTGATTAGATGAATTCAGG + Intergenic
1095909181 12:47408575-47408597 TATGGCAATTATAGGGATGGGGG - Intergenic
1096897201 12:54834553-54834575 TATGCTAATTAGTTGGATTGTGG - Intronic
1100559414 12:95733165-95733187 AATGGTAATAAGAGGGAATATGG - Intronic
1105235009 13:18542615-18542637 AATGGTAAGAAGAAGGATTCAGG + Intergenic
1109085539 13:57966569-57966591 TAAGGTAATTAGGGGGATTTTGG - Intergenic
1112555336 13:100462886-100462908 TATACGAAGTAGAGGGATTCTGG + Intronic
1114819528 14:26000959-26000981 TATCAAAATTTGAGGGATTCAGG + Intergenic
1114880790 14:26783052-26783074 AATGGTAATTAGAGAAATGCTGG + Intergenic
1115547039 14:34473131-34473153 TATGGAAATTAGAACGAGTCAGG - Intergenic
1119552462 14:75524941-75524963 TTTGGTAAATAGAGGGATGGAGG + Intronic
1120453284 14:84698878-84698900 TATAGTAATTAGAGAAATTTTGG - Intergenic
1121269105 14:92626131-92626153 AATGATAATTAAAGGAATTCGGG - Intronic
1128848716 15:70928237-70928259 TATAGTAAGTAGAGATATTCTGG + Intronic
1130263720 15:82380078-82380100 AATGATAATAAAAGGGATTCAGG - Intergenic
1130277567 15:82489567-82489589 AATGATAATAAAAGGGATTCGGG + Intergenic
1130469892 15:84216756-84216778 AATGATAATAAAAGGGATTCGGG + Intergenic
1130477380 15:84331319-84331341 AATGATAATAAAAGGGATTCGGG + Intergenic
1130494385 15:84456811-84456833 AATGATAATAAAAGGGATTCGGG - Intergenic
1130592181 15:85221380-85221402 AATGATAATAAAAGGGATTCGGG + Intergenic
1131880086 15:96852908-96852930 TGAGGTAATTGGAGGGATTGAGG + Intergenic
1133598728 16:7318381-7318403 TTTGGTGATGAGAGTGATTCTGG + Intronic
1134563698 16:15232514-15232536 TATGAAAATTATAGGAATTCTGG - Intergenic
1134738799 16:16524179-16524201 TATGAAAATTATAGGAATTCTGG + Intergenic
1134928700 16:18187974-18187996 TATGAAAATTATAGGAATTCTGG - Intergenic
1136415218 16:30098756-30098778 TATGATAATTAAAGGGATTCAGG + Intergenic
1140602344 16:76492297-76492319 TATGTTAATTAGTGTGATTGTGG + Intronic
1141036040 16:80626749-80626771 TATGGAAGTTAGGGGGATACTGG + Intronic
1150096703 17:62382373-62382395 TATGTTAATTAGATTGATTGTGG - Intronic
1154514536 18:15147391-15147413 AATGGTAAGAAGAAGGATTCAGG - Intergenic
1157349371 18:46870927-46870949 AATGGTAATAAAAGGAATTCAGG + Intronic
1158811492 18:61042402-61042424 TATGTTAATTAGATTGATTTTGG - Intergenic
1158813684 18:61068647-61068669 TATTGTGATTTGAAGGATTCAGG - Intergenic
1159733716 18:72065678-72065700 TCTGGTAATTACAAGGAGTCGGG + Intergenic
1162272589 19:9628451-9628473 AATGATAATTAAAGGAATTCGGG + Intronic
1165686259 19:37823126-37823148 TTTGATAATTAGAGCAATTCAGG - Intergenic
1167904737 19:52649558-52649580 AATGATAATTAAAGGAATTCAGG + Intronic
1168218652 19:54944859-54944881 TATGTTAATTAGCTGGATTGTGG - Intronic
1168460549 19:56553003-56553025 TATGGTAATTAGCTTGATTGTGG + Intronic
926550192 2:14292250-14292272 TAAGGTAATAGGAGAGATTCAGG + Intergenic
927378181 2:22443443-22443465 TATGGAAATTAGAGGGAATATGG + Intergenic
937646679 2:124273524-124273546 AATGGAAATTGTAGGGATTCTGG - Intronic
938514783 2:131992017-131992039 AATGGTAAGAAGAAGGATTCAGG - Intergenic
940723369 2:157306437-157306459 AATGGTTAGTAGAGGGAGTCGGG + Intronic
943679083 2:190748985-190749007 TATGGGGTTTAGAGAGATTCTGG - Intergenic
944727862 2:202489687-202489709 TATAGTTAGTAGTGGGATTCTGG + Intronic
1169570896 20:6904085-6904107 TATTGAAATTAGAGTGCTTCAGG - Intergenic
1169967883 20:11237617-11237639 TATAGAAAGTAGAGGAATTCTGG + Intergenic
1170007581 20:11686094-11686116 TCTGGTACTCAGAGGGGTTCAGG + Intergenic
1173277387 20:41596619-41596641 AATGATAGTTAAAGGGATTCAGG + Intronic
1173369822 20:42425662-42425684 TATGTTAATTAGATTGATTGTGG + Intronic
1177976644 21:27859918-27859940 AATGGTAAGAAGAAGGATTCAGG + Intergenic
1178507622 21:33175780-33175802 TATGCTAATTAGCTGGATTGTGG + Intergenic
1181375527 22:22454869-22454891 AAAGGTAGTTAAAGGGATTCAGG + Intergenic
1182006065 22:26960635-26960657 TATAGTAACTAGAGGGATAGTGG + Intergenic
949903840 3:8842092-8842114 TAGGCTAATTAGAGGGTTCCAGG + Intronic
950602270 3:14045381-14045403 TATGGTAATTAGAGGGATTCGGG - Intronic
950725430 3:14913999-14914021 CAGGGTAATCAGAGGGATGCAGG - Intronic
953209827 3:40866091-40866113 AAAAGTTATTAGAGGGATTCAGG - Intergenic
953219132 3:40951668-40951690 TATGGTAATTAGCTGAATTGTGG - Intergenic
953501921 3:43444840-43444862 CATCTTAAATAGAGGGATTCAGG + Intronic
954907131 3:54072328-54072350 AATGATAATTAAAGGAATTCGGG + Intergenic
955675852 3:61448297-61448319 TATGGTTATTATAAGGATTTTGG - Intergenic
957137461 3:76307596-76307618 TAAGGGAATTAGAGGGATTTTGG - Intronic
957869355 3:86068888-86068910 TATGGTAGTTTGAGAGAATCAGG + Intronic
958093922 3:88915645-88915667 TATGTTAATTAGATTGATTGTGG - Intergenic
959347186 3:105212006-105212028 TTTGTTAATTAGAGGTATTCAGG + Intergenic
960707006 3:120491443-120491465 TTTGATAATTAAAGGGATTCAGG + Intergenic
962454441 3:135552212-135552234 TATGATAAGTAGATGGATTGAGG - Intergenic
962491058 3:135894446-135894468 TATGCTTATTAGGGGGGTTCTGG + Intergenic
963894293 3:150668988-150669010 TATGGTAACTCTAGGGATTTGGG - Intronic
965172490 3:165284400-165284422 TATCGGCATTAGAGGGATTCTGG - Intergenic
965915451 3:173840960-173840982 TACAGTATTTACAGGGATTCTGG - Intronic
969924127 4:10569666-10569688 AATGGTCATTATAGGAATTCTGG + Intronic
973175652 4:47202083-47202105 TATGGAAATTATAGGGATTATGG - Intronic
973681045 4:53320217-53320239 TATGGTAAACAGATGGATTTTGG - Intronic
975270666 4:72428876-72428898 TATGGGAATAAGTGGGTTTCGGG - Intronic
976448249 4:85156520-85156542 TATGCTATTTAGAGGTATTAAGG - Intergenic
976772116 4:88664532-88664554 AATGGTAATGAGAGGATTTCAGG + Intronic
977537448 4:98271331-98271353 AATGATAATTAGAGGGGTGCTGG + Intronic
978801463 4:112759443-112759465 TGTGGTAATTAGAAAGATTTGGG - Intergenic
981891701 4:149746058-149746080 TATCGTAATTAGCAGGATGCAGG + Intergenic
984579392 4:181493878-181493900 TATGGTAAATAGAGGTATGGAGG - Intergenic
990174977 5:53097661-53097683 TATGTTAATTAGTTGGATTATGG + Intronic
991294359 5:65064949-65064971 TATGGTAATTAATGGTAATCTGG + Intergenic
994362535 5:98869382-98869404 TATCATTATTAGGGGGATTCTGG - Intronic
999784696 5:154880481-154880503 TAGGATAATTAAAGGGATTCGGG + Intergenic
999840520 5:155420712-155420734 TATGATAATTAGATTGATTATGG - Intergenic
999920558 5:156314999-156315021 TATGTTAATTAGATTGATTGTGG - Intronic
999933974 5:156465096-156465118 TATGATTACCAGAGGGATTCAGG + Intronic
1000413494 5:160958971-160958993 AATGTTAATAAGAGGGATGCTGG + Intergenic
1000557770 5:162747936-162747958 TATGTTAATTAGATTGATTGTGG + Intergenic
1005574720 6:27180311-27180333 TATGATAATTAAAGGGATTCAGG + Intergenic
1006652754 6:35565260-35565282 AATGATAGTTAAAGGGATTCGGG - Intergenic
1008273050 6:49512054-49512076 TATGGTACCTTGAGTGATTCAGG - Exonic
1008431057 6:51417253-51417275 TAGGTTAATTAGAGAAATTCTGG - Intergenic
1009764553 6:68054702-68054724 TCTGGTAATTACAGAGATTGGGG + Intergenic
1010328252 6:74590113-74590135 TATGTTAATTAGCTGGATTGTGG - Intergenic
1021630475 7:22640243-22640265 TATGTTAATTAGTGTGATTGTGG - Intergenic
1023453236 7:40310557-40310579 GATGGTAATAACAGGGATACTGG + Intronic
1026224515 7:68428728-68428750 TATGTTAAGTGGAGGTATTCTGG + Intergenic
1027379500 7:77591372-77591394 TATGGAAAATAGAATGATTCAGG - Intronic
1028697650 7:93734487-93734509 TGTGTTAATTAGAGGTATTATGG - Intronic
1030856836 7:114568705-114568727 AATGGTAATTTAAGGGATACAGG - Intronic
1031187361 7:118500053-118500075 AAGGGTAGTAAGAGGGATTCTGG - Intergenic
1031417280 7:121509289-121509311 TATGATAATTAAAGGGATTCAGG - Intergenic
1033788683 7:144765120-144765142 TATGATGATAAGAGGGAATCAGG + Intronic
1033950279 7:146776581-146776603 TATGGGAATTAGAGAGATGTGGG + Intronic
1036981113 8:13471352-13471374 TATGTTAATTAGATTGATTGTGG + Intronic
1037509504 8:19567371-19567393 TATGTTAATGAGAGTGAGTCAGG + Intronic
1038385889 8:27144581-27144603 AATGGTTATTAGAGGCGTTCAGG + Intergenic
1038625583 8:29190014-29190036 TATGGTAATTATAGAGATGTAGG + Intronic
1042374645 8:68036375-68036397 TATGTTAATTTGAGGTACTCGGG + Intronic
1042994222 8:74676844-74676866 TATGTTAATTAGCTGGATTGTGG + Intronic
1044459396 8:92427559-92427581 TATGGCTATTAGAGAGAGTCTGG + Intergenic
1046499651 8:115059386-115059408 TATGATAGTTTGAGGGATTTAGG + Intergenic
1046697035 8:117352685-117352707 TATGTTAATTAGATTGATTGTGG + Intergenic
1046825137 8:118681420-118681442 TATGTTAATTAGCTTGATTCAGG + Intergenic
1047530819 8:125673341-125673363 TATTGGTATTAGAGTGATTCTGG + Intergenic
1048290890 8:133181007-133181029 TATGGGAATTTTAGGCATTCAGG - Intergenic
1051881445 9:21844384-21844406 TTTTGTAATTAGGGGGATACTGG - Intronic
1055318809 9:75061655-75061677 TGTTTAAATTAGAGGGATTCTGG + Intronic
1058365927 9:104208422-104208444 TATGTTAATTAGCTCGATTCTGG - Intergenic
1058489803 9:105485590-105485612 TATGGTGATTTGAGGGATCAAGG + Intronic
1185989214 X:4874173-4874195 TATGTTAATTAGTGTGATTGTGG - Intergenic
1188333562 X:28899935-28899957 CATGGTAATTAGCAGGAGTCAGG + Intronic
1189091979 X:38093120-38093142 TATGGCAATTAGAGGAAGTTAGG + Intronic
1189820054 X:44861597-44861619 AATAGGAAATAGAGGGATTCAGG + Intergenic
1190445998 X:50524866-50524888 TATGTTAATTAGCTGGATTGTGG + Intergenic
1192487889 X:71546332-71546354 TATTGTATTTAGAAGGTTTCAGG + Intronic
1197531428 X:127632566-127632588 TATGTTAATTAGATTGATTATGG - Intergenic
1199709096 X:150455698-150455720 TAGGGTGATTAGAGGGCTTGAGG - Intronic
1201914901 Y:19171444-19171466 TATGATAATTAAAGGGATTTGGG + Intergenic