ID: 950602376

View in Genome Browser
Species Human (GRCh38)
Location 3:14045970-14045992
Sequence CTGCATTTGCTTGAGGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 7, 3: 17, 4: 202}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950602376 Original CRISPR CTGCATTTGCTTGAGGGGGA GGG Intronic
900089077 1:911526-911548 GTGCATGTGCTTGCGGGGGCTGG + Intergenic
901501212 1:9653485-9653507 GTGCCGTTGCTTGCGGGGGAAGG + Exonic
902170063 1:14602912-14602934 CTGCATTTGTTAGAAGGGGATGG + Intronic
902302903 1:15515284-15515306 CTGCATTTGCTTGAAGTGTAAGG - Intronic
904761315 1:32806465-32806487 CTGCAGGTACTTAAGGGGGATGG - Exonic
907369462 1:53991508-53991530 CTGCATTTCCTGGAGAGGGATGG - Intergenic
910288525 1:85579056-85579078 CAGCATTTGCTAGAGGGAGTGGG - Intergenic
910457801 1:87416212-87416234 CTGCATTTGCTTAGGGCGGGTGG - Intergenic
910511129 1:88006228-88006250 CTGAATTTACATGATGGGGAGGG - Intergenic
912183059 1:107241671-107241693 CTGCATTTTCTTGAGGGAACAGG - Intronic
912284352 1:108352952-108352974 CAGCATTTGCTTGTTGGGAAAGG + Intergenic
912400707 1:109389399-109389421 ATGCATTTGCTTTAGGGATAAGG - Intronic
914204441 1:145515184-145515206 TTGCTTTTGCTTGTGGGGTATGG + Intergenic
914483565 1:148088372-148088394 TTGCTTTTGCTTGTGGGGTATGG + Intergenic
914974053 1:152341715-152341737 CCGCATTTTTTTGAGGGGAAGGG + Intergenic
914989823 1:152489241-152489263 CAGCATTTGCTTGTCTGGGAAGG + Intergenic
915982091 1:160426538-160426560 CTGTATTGGGTTGAGGGGCAAGG + Exonic
916140757 1:161695058-161695080 CTGCATTTGCTTGTCTGGAAAGG - Intergenic
918703320 1:187632148-187632170 CTGCCTTGGCCTAAGGGGGAGGG - Intergenic
920029683 1:203029010-203029032 CTGCATTTGCTGTACTGGGAGGG + Intronic
922247727 1:223817193-223817215 CTGCATGTGGAGGAGGGGGAGGG + Intronic
924090121 1:240493026-240493048 CTGGATTTTCTTGAGTCGGAAGG + Exonic
924927131 1:248693950-248693972 GTGCATTTGGTTGAGAGGGCAGG + Intergenic
1062937754 10:1400811-1400833 TTTAATTTGCTTGAGTGGGAGGG + Intronic
1064737720 10:18399746-18399768 CTGCATTTGTTTGAGTGTGGTGG - Intronic
1065842844 10:29718720-29718742 CTACATGTGCCTGAGGGGGTGGG + Intronic
1066563021 10:36690969-36690991 CTGCTTTTGCTTGATAGGTAAGG - Intergenic
1068610300 10:59052628-59052650 CTTCATTGAGTTGAGGGGGATGG - Intergenic
1069234207 10:66049780-66049802 TAGCATCTACTTGAGGGGGAAGG + Intronic
1070552435 10:77501405-77501427 GTGCATGTGCCTGAGGAGGATGG + Intronic
1070814474 10:79314107-79314129 CTGCTTTTGCTTGAGTGAGCAGG - Exonic
1071038018 10:81270593-81270615 CTGGAGATGCTTCAGGGGGAAGG - Intergenic
1072388607 10:94958844-94958866 CAGCATTTGCTTGTGGGTAAAGG + Intronic
1072842565 10:98791211-98791233 CTGGAATTGACTGAGGGGGAGGG + Intronic
1074971929 10:118545893-118545915 CTGCAGGTGCTTGTGGGGCAGGG - Intergenic
1075322044 10:121499295-121499317 CTGAATTAGCTTGAGGTGGAGGG - Intronic
1076793811 10:132789375-132789397 CTGGAATTGCTGGAAGGGGAAGG + Intergenic
1077702566 11:4455664-4455686 TTGCAACTGCTGGAGGGGGAGGG - Intergenic
1078771950 11:14359210-14359232 CTGCATATGCATGAGGGGGCGGG + Intronic
1079415061 11:20226467-20226489 CTGCATTTTCTTGGTGGGCAGGG + Intergenic
1079426264 11:20344603-20344625 CTGCATTTGCTTGTCTGGAAAGG - Intergenic
1082083045 11:48026896-48026918 ATGCCTTTGCATGAGAGGGAAGG + Intronic
1082548184 11:54359950-54359972 CTCCATTTGATTGAGCGGTATGG + Intergenic
1084084387 11:66848310-66848332 CTGAACTTGCTTGAGGGGTGGGG - Intronic
1086644012 11:89196658-89196680 CTGCATTTGTTAGAAGGGGGTGG - Intronic
1089819740 11:121213582-121213604 ATGCAGTGGCTTGAGGGTGAGGG - Intergenic
1092965715 12:13640045-13640067 CTGCACTTCCTTGAGGAAGAGGG + Intronic
1093932706 12:24970193-24970215 CTGCATGTGCATTAGGAGGATGG - Intergenic
1095506728 12:42906298-42906320 CTGCATATGCAAGAGGGGTAAGG + Intergenic
1096292073 12:50351705-50351727 CTGGACTTGCTTAAGGGTGAGGG + Exonic
1097654206 12:62341591-62341613 CTGCATTTGCTTGTCTGGAAAGG + Intronic
1100174016 12:92008913-92008935 ATTAATTTGCTTGAGGGGGTAGG + Intronic
1103294112 12:119871499-119871521 ATTCATTTGGTTGTGGGGGAGGG - Intronic
1104022568 12:125003185-125003207 TTGCATGTGCCTGAGGGTGATGG + Intronic
1108113676 13:47104427-47104449 CAGCATTTGCTTGTGTGGAAGGG - Intergenic
1112016922 13:95338845-95338867 CTGCATATGCTTTAGAGGCAAGG + Intergenic
1112220680 13:97486714-97486736 CTGCATTTTCTTGGAGGGAAAGG - Intergenic
1113927815 13:113951166-113951188 GAGCATTCGCTGGAGGGGGACGG - Intergenic
1116505902 14:45681051-45681073 CTGCTTTTACTTAAGGTGGAAGG + Intergenic
1119037328 14:71241380-71241402 CTGCCTTTGCTGGAAGGGAAAGG + Intergenic
1119143413 14:72288476-72288498 CTGCATTGGTTTGACTGGGATGG + Intronic
1120994587 14:90407093-90407115 CAGCATTCCCTGGAGGGGGAGGG - Exonic
1122036822 14:98954990-98955012 CTGTCTTTTCTTGAGGAGGAGGG - Intergenic
1122975401 14:105168810-105168832 CTGCATATGCATGAGGGGGCGGG + Exonic
1125286369 15:38096995-38097017 CTGCATTTGCTTGTCTGGAAAGG - Intergenic
1126175315 15:45730433-45730455 CTGGAGTTCTTTGAGGGGGATGG + Intergenic
1126267871 15:46775764-46775786 CTGCATTTGGGGGAGGGGAAGGG - Intergenic
1127687495 15:61363321-61363343 CTGCATTTGCTTGTCTGGAAAGG + Intergenic
1128052230 15:64674583-64674605 CTGAATTTGCTTGAAGGAGAAGG - Exonic
1128329543 15:66746493-66746515 CTGGATTTGCTCTAGGGGGGTGG + Intronic
1129761753 15:78132850-78132872 CTCCATTTGGTGGATGGGGAAGG - Intronic
1130263824 15:82380676-82380698 CTGCCTCTGCTTGAGGGGGAGGG + Intergenic
1130277469 15:82488971-82488993 CTGCTTCTGCTTGAGGGAGAAGG - Intergenic
1130469792 15:84216160-84216182 CTGCCTCTGCTTGAGGGGGAGGG - Intergenic
1130477280 15:84330723-84330745 CTGCCTCTGCTTGAGGGGGAGGG - Intergenic
1130494485 15:84457407-84457429 CTGCCTCTGCTTGAGGGGGAGGG + Intergenic
1130592081 15:85220784-85220806 CTGCCTCTGCTTGAGGGGGAGGG - Intergenic
1131547967 15:93331830-93331852 CTGCACTTGGCTGTGGGGGAGGG + Intergenic
1131802889 15:96090025-96090047 CTGTATTTTTTTGAGGGGGGTGG - Intergenic
1131944769 15:97608120-97608142 CTGAATTTGCTGGAGGGAGGTGG + Intergenic
1133560582 16:6946592-6946614 TTTCATTTTTTTGAGGGGGAAGG + Intronic
1135841948 16:25884967-25884989 ATGCATTTGGTTGAGTGAGAAGG + Intronic
1135887389 16:26323147-26323169 CAGCATTTGTTTTAGGAGGATGG + Intergenic
1137757662 16:50915348-50915370 AGGCATTTGCTTGAAAGGGATGG + Intergenic
1138402585 16:56759282-56759304 CTGCATTTGCATTAGAGTGAAGG + Intronic
1140320592 16:73947831-73947853 GTCCATTTGCTTGAGGGGTTGGG - Intergenic
1140742133 16:77951083-77951105 CTGTATTTCCTTCAGGTGGATGG - Intronic
1142038157 16:87875320-87875342 ATGCATTTGCTTCAGGTGGGCGG + Intergenic
1143329197 17:6121366-6121388 CTGCATTGGCTTGGGCGGGGTGG - Exonic
1143700066 17:8652045-8652067 CTGCAATTGCATTAGGGGAAAGG + Intergenic
1147967313 17:44200106-44200128 CAGCATTTGCTCCAGGGGGCGGG + Intronic
1148570099 17:48661468-48661490 CTGGATGTACTTCAGGGGGAGGG + Intergenic
1151822046 17:76501721-76501743 GTGCTTTTTCTTGATGGGGAGGG - Intronic
1156138527 18:34076188-34076210 CTGCATTTGCGTAGGGGAGAGGG - Intronic
1156492551 18:37505007-37505029 CTGCAGTGGCTGGAGGAGGATGG - Intronic
1156763410 18:40621146-40621168 CTGCTTCTGCTTAAGAGGGAGGG - Intergenic
1157109073 18:44802652-44802674 CTGAATCTGCTTGAGAGAGAAGG + Intronic
1157530203 18:48413917-48413939 CAGCATTTTCTTGAGGGAGATGG - Intergenic
1158577855 18:58655382-58655404 CAGCATTTGCTTGTCTGGGAAGG + Intergenic
1160852529 19:1199796-1199818 CTCCATCTGCTTCAGGGTGATGG - Intronic
1160946612 19:1646724-1646746 CTGCCTTTGCTCTGGGGGGAGGG + Intronic
1161698603 19:5783542-5783564 CTGCAGCTCCTTGACGGGGAAGG + Exonic
1166258302 19:41620918-41620940 CTGCGTTTGCCTGAGAGGAAGGG + Intronic
1167597070 19:50433335-50433357 TTCCTTTTGCTTGATGGGGATGG + Intronic
931117925 2:59184523-59184545 TGGCCTTTGCATGAGGGGGAGGG + Intergenic
935934918 2:108171228-108171250 TTGAATGTGCTTGAGGAGGAAGG - Intergenic
936329534 2:111535852-111535874 CTGCATCTGCTTACGGTGGAAGG + Intergenic
939224344 2:139346178-139346200 CTTCCTTTCCTTGAGGGGGTGGG - Intergenic
940216826 2:151311092-151311114 CAGCACTTGCTTCTGGGGGAGGG - Intergenic
941645786 2:168039635-168039657 CTGCCTTTGCCAGAGGTGGAGGG + Intronic
943296287 2:186144289-186144311 CAGCATTTGCTTGTGTGGAAAGG - Intergenic
943514240 2:188864177-188864199 CAGCATTTGCTTGTCTGGGAAGG - Intergenic
943541197 2:189216872-189216894 CTAAATTTGCTGGAGGGGAAAGG + Intergenic
943552286 2:189355989-189356011 CAGCATTTGCTTGTGGGTAAGGG + Intergenic
945294417 2:208156668-208156690 CTGCCTTTGCTTAAGTGGGTAGG + Intergenic
948168372 2:235880336-235880358 CAGCATTTGTCTGAGTGGGAAGG + Intronic
948888769 2:240896894-240896916 GTGCAGGTGCTGGAGGGGGATGG - Intergenic
1168887761 20:1271721-1271743 GTGGATTTGCTGGAGGGAGAGGG + Intronic
1170318132 20:15064665-15064687 CTGCATTTGCCTGAGTGGAGCGG - Intronic
1171560312 20:26118746-26118768 CTGCAACTGCTTCAGGTGGAAGG + Intergenic
1173411967 20:42819330-42819352 CAGCATTTGCTTGTCTGGGAAGG - Intronic
1177529611 21:22342332-22342354 CTAAATTTGCTTGGGGGTGAGGG - Intergenic
1178954656 21:37011327-37011349 CTGCATATGTTTGTGGGGTAAGG + Intronic
1183069780 22:35387903-35387925 CTGGATTTTCTGAAGGGGGAGGG - Intronic
1184418269 22:44364475-44364497 CTGGCTTGGCTTGTGGGGGATGG - Intergenic
1184648545 22:45909062-45909084 CCGCATGTGCTGGAGGGAGAGGG - Intergenic
1184777991 22:46632851-46632873 CTGCCTGTGCTTGCTGGGGAGGG + Intronic
1184809520 22:46821461-46821483 CAGCATTTGCTTGTGTGGAAAGG + Intronic
950602376 3:14045970-14045992 CTGCATTTGCTTGAGGGGGAGGG + Intronic
953701811 3:45201833-45201855 GTGCATCTGCTTGAGAGAGAAGG - Intergenic
953899752 3:46833470-46833492 CTGTGTGTGCTTGAGGGGGCCGG + Intronic
954127409 3:48539601-48539623 CTGCTTATGCATGAGGGGCATGG - Intronic
954331402 3:49892520-49892542 CTGCTTTTCTTTGAGGGGGATGG - Intronic
956082956 3:65579000-65579022 ATGCATTTTTTTGCGGGGGAGGG + Intronic
959371900 3:105537457-105537479 CTGCAATTGGGGGAGGGGGAAGG - Intronic
959418174 3:106102753-106102775 CAGCATTTGCTTGTCTGGGAAGG + Intergenic
959538868 3:107518032-107518054 TTGCATTGGCTTGAGGAGAAAGG + Intergenic
961465689 3:127079749-127079771 CTGCATATGAGTGAGGGAGAGGG - Intergenic
962602877 3:137008038-137008060 CTGTATTTGCTTCATGGGAATGG + Intronic
964383235 3:156119618-156119640 CTTAAGTTGATTGAGGGGGAGGG + Intronic
965811439 3:172594816-172594838 CTGCATTGCCTTGGCGGGGAGGG - Intergenic
967321195 3:188196996-188197018 CTGCATTTCCTTGAGAGCAATGG + Intronic
968711475 4:2122496-2122518 TTGCATTTCCTTGATGGGGATGG - Intronic
969223187 4:5774697-5774719 GTGCTTCTGTTTGAGGGGGAGGG + Intronic
969455379 4:7297145-7297167 CTGCATTAGGTGGAGGGGGCTGG + Intronic
973177465 4:47225303-47225325 ATGCATTTGGTGGAGGGGGCAGG + Intronic
974392116 4:61284771-61284793 TTGCATTATCTTGTGGGGGAGGG + Intronic
975078801 4:70249266-70249288 CTGAATTTTCTTTGGGGGGATGG - Exonic
977632777 4:99262011-99262033 CAGCATTTGCTTGTTGGGAAAGG + Intergenic
980026607 4:127775814-127775836 CAGCATGTACTTGTGGGGGAGGG - Intergenic
985277551 4:188252609-188252631 CTCCTTTTGCTTGTGGGGGGCGG + Intergenic
985760087 5:1744333-1744355 CTGCATTTGTTTCCTGGGGATGG - Intergenic
985996119 5:3597920-3597942 CTGCCTGTGTTTGCGGGGGAGGG + Intronic
990013687 5:51031344-51031366 CTTCTTTTGCTTAAGGAGGAAGG + Intergenic
990623297 5:57583681-57583703 ATATATTTGCTTGAGGGGAAAGG + Intergenic
992072316 5:73159389-73159411 CCGCATGTCCTTGAGGGGGTGGG + Intergenic
993947819 5:94136662-94136684 CAGCATTTGCTTGTGTGTGAAGG + Intergenic
994056531 5:95422879-95422901 CTGCTTTTGATTGAAGGGGAAGG - Intronic
996875580 5:128237007-128237029 CTTTATTTGCTTTTGGGGGACGG - Intergenic
997865500 5:137459322-137459344 CTATTTTTGTTTGAGGGGGAAGG - Intronic
998549880 5:143067119-143067141 CTTAATTTCCTGGAGGGGGATGG + Intronic
998689029 5:144566639-144566661 CCACATTTGCTTCTGGGGGATGG + Intergenic
998755431 5:145374195-145374217 CAGCATTTGCTTGTCTGGGAAGG + Intergenic
999244100 5:150144280-150144302 CAGCCTTTGCCTGAGGGGGATGG - Intronic
1002674684 5:180901270-180901292 CTGCATGTGCATCAGAGGGAAGG - Intronic
1003189062 6:3856988-3857010 CTGCTTTTGCTTTTGCGGGATGG + Intergenic
1004900436 6:20188677-20188699 CTGCATGTGCATTAGGAGGAGGG - Intronic
1006122735 6:31817012-31817034 CTGCGTCTGCTTGGTGGGGATGG - Exonic
1006124598 6:31829206-31829228 CTGCGTCTGCTTGGTGGGGATGG - Exonic
1008078448 6:47170119-47170141 CTGTACTTGCTAGAGGGGTAGGG + Intergenic
1010485255 6:76403920-76403942 CTGCCTTTGCTGGAGAGGAAAGG + Intergenic
1011640130 6:89411047-89411069 CTGCATTTTCTTAAGGTGTAAGG - Intronic
1012601542 6:101104349-101104371 CTGCATTTGCTAGAGCAGAAAGG + Intergenic
1013350843 6:109304307-109304329 CTTCACTTGCTGGAGAGGGAAGG + Intergenic
1013781402 6:113732599-113732621 CTGCTTTTGTTGGAGGGTGAGGG - Intergenic
1015011161 6:128350096-128350118 ATGCATTCACTTGATGGGGATGG + Intronic
1016412763 6:143800908-143800930 CAGCATTTGCTTGTGTGGAAAGG + Intronic
1016634843 6:146276409-146276431 TTGCATTTGCTTTAGAGGAAGGG - Intronic
1019510467 7:1415146-1415168 CTGCAATTGCTGGATGGGGATGG + Intergenic
1021392769 7:20114592-20114614 CTGCCTTTCCTCTAGGGGGAAGG + Intergenic
1022489013 7:30802315-30802337 CTGCATTAACCTGAGAGGGAAGG + Intronic
1022500871 7:30881770-30881792 CTGAATTTGTTTGAGGGGTGTGG + Intronic
1022559279 7:31332611-31332633 CTGCAATAGCTTGAGAGGGCTGG + Intergenic
1024099711 7:46017347-46017369 CAGCATTTGCTTGTCTGGGAAGG - Intergenic
1024888263 7:54169592-54169614 CTGCATGTGCATTAGGAGGATGG + Intergenic
1026675935 7:72428002-72428024 CTGCATTTGCGTGGTGGGGCAGG - Intronic
1028647975 7:93119649-93119671 CTGCACTTGCTGTAGGGGGCGGG - Intergenic
1029865667 7:103625350-103625372 CTAGATTTGGTTGAGGGAGAAGG - Intronic
1031390491 7:121207955-121207977 CTGCATTAGGTTGGTGGGGAAGG - Intronic
1031417375 7:121509864-121509886 CAGCATTTGCTTGAAGGGGAGGG + Intergenic
1032673398 7:134106533-134106555 CTGCATTTGATACAGGAGGAGGG - Intergenic
1032779787 7:135155943-135155965 CAGCATTTGCTTGTATGGGAAGG + Intronic
1035317357 7:158004730-158004752 ATGCATTTGCTTGAAGGAGATGG - Intronic
1038047908 8:23782032-23782054 GTGACTTTGCTTGAGTGGGAAGG - Intergenic
1038660683 8:29494057-29494079 CTGCATTTGAATGAGGAGAAAGG - Intergenic
1040459319 8:47632025-47632047 CTGCATTTGGGTGCTGGGGAGGG - Intronic
1040529325 8:48253700-48253722 CTGCAATGGCTTGAGTGGGTTGG + Intergenic
1041819208 8:62010474-62010496 CTGCATTTGCTGGATGGGGATGG - Intergenic
1042619544 8:70690259-70690281 ACGCATCTACTTGAGGGGGAGGG - Intronic
1043140440 8:76581998-76582020 TTGTATTTGCTTAAAGGGGAAGG + Intergenic
1044192948 8:89341863-89341885 CTCCATTTGTTTGAGGAGAAAGG - Intergenic
1048462895 8:134637469-134637491 CTGAATTTGGGTGAGGAGGAAGG - Exonic
1049813668 8:144587999-144588021 CTGCATTTCCCTGATGGTGATGG - Intronic
1050177748 9:2885864-2885886 CAGCATTTGCTTGTGTGAGAAGG - Intergenic
1050991738 9:12164209-12164231 CAGTATTTGCTCTAGGGGGAGGG - Intergenic
1051852547 9:21526594-21526616 CAGCATTTGCTTGATTGGAAAGG + Intergenic
1052303092 9:26975136-26975158 CAGCAGCTGCCTGAGGGGGAGGG + Intronic
1055971077 9:81913555-81913577 CTGCATCTACTTGAGTGGGTTGG + Intergenic
1055972803 9:81928597-81928619 CTTCATCTGCTTGAGTGGGTTGG + Intergenic
1055974556 9:81943669-81943691 CTTCATCTGCTTGAGTGGGTTGG + Intergenic
1055979584 9:81988902-81988924 CTTCATCTGCTTGAGTGGGTTGG + Exonic
1056701474 9:88914659-88914681 GTGCATATGGTTGAGGGGGTGGG + Intergenic
1056923056 9:90809016-90809038 GTGCATATGCTTGAGGTGGAAGG + Intronic
1060089905 9:120733433-120733455 CAGCATTTGCTGGAAGGGGCTGG - Intergenic
1060458657 9:123826485-123826507 CAGCAGTGGCTTGAGGGGCATGG - Intronic
1061580810 9:131534736-131534758 CTGCATGTGTTTGAGGGGGCAGG - Intergenic
1187998137 X:24951347-24951369 CTGCATTTGGTGGGGGGGGGGGG - Intronic
1193381944 X:80826389-80826411 CAGCATTTGCTTGCCTGGGAAGG + Intergenic
1193681159 X:84519968-84519990 CTCCATTTTCCTGAGGGGCAAGG - Intergenic
1193821794 X:86174053-86174075 CTTCATTTAGTTGGGGGGGAAGG + Intronic
1197347628 X:125344237-125344259 TTGCATTTGCTTCTGGGAGAAGG - Intergenic
1198758222 X:140002832-140002854 CAGCATTTGCTTGTTGGGAAAGG - Intergenic
1199091191 X:143694466-143694488 TTGCATTTACTTTATGGGGAAGG + Intergenic
1199324825 X:146486169-146486191 CAGCATTTGCTTGACCAGGAAGG + Intergenic
1199781980 X:151070006-151070028 CTGCCCTTGCTTGAGGAGGTAGG + Intergenic
1201908225 Y:19106541-19106563 CTGTATTTGCTTGAGGAAGGTGG + Intergenic
1202088488 Y:21163659-21163681 CTGCATTTACTTGCAGGGTATGG + Intergenic