ID: 950603083

View in Genome Browser
Species Human (GRCh38)
Location 3:14052714-14052736
Sequence CAGAAAAGGCAGAAGTGTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 330
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 301}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950603083_950603087 21 Left 950603083 3:14052714-14052736 CCTGAACACTTCTGCCTTTTCTG 0: 1
1: 0
2: 3
3: 25
4: 301
Right 950603087 3:14052758-14052780 TTGTACACATTTGTATTGGCAGG 0: 1
1: 0
2: 2
3: 10
4: 153
950603083_950603085 -3 Left 950603083 3:14052714-14052736 CCTGAACACTTCTGCCTTTTCTG 0: 1
1: 0
2: 3
3: 25
4: 301
Right 950603085 3:14052734-14052756 CTGTATACATTTATATTGACAGG 0: 1
1: 0
2: 0
3: 15
4: 215
950603083_950603086 17 Left 950603083 3:14052714-14052736 CCTGAACACTTCTGCCTTTTCTG 0: 1
1: 0
2: 3
3: 25
4: 301
Right 950603086 3:14052754-14052776 AGGATTGTACACATTTGTATTGG 0: 1
1: 0
2: 0
3: 14
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950603083 Original CRISPR CAGAAAAGGCAGAAGTGTTC AGG (reversed) Intronic
900913819 1:5620542-5620564 CAGAAAAGGCAACAGTGGCCTGG - Intergenic
902551129 1:17220178-17220200 CAGAAGAGGCAGGAGTGTGCAGG - Intronic
904562471 1:31407813-31407835 CTTAAAAGACAGAAGTGGTCTGG - Intergenic
905469196 1:38179081-38179103 CAGAAAAGAAAAAAGGGTTCTGG + Intergenic
906297454 1:44657966-44657988 CAGAGAAGGCAGAGGTGTTGAGG - Intronic
908728287 1:67199735-67199757 CCATGAAGGCAGAAGTGTTCAGG + Intronic
909981638 1:82109321-82109343 GAGGAAAGGCAGACATGTTCAGG - Intergenic
913332497 1:117678948-117678970 CAGAAAAAGCACAGGTGCTCTGG - Intergenic
914003218 1:143710179-143710201 CAGAAAAGGCAGAAGCTCTCTGG + Intergenic
914094430 1:144532669-144532691 CAGGAAAGGCAGAAGCTCTCTGG + Intergenic
914304093 1:146401219-146401241 CAGGAAAGGCAGAAGCTCTCTGG - Intergenic
914515674 1:148372022-148372044 CAGAAAAGGCAGAAGCTCTCTGG + Intergenic
916591746 1:166197808-166197830 CAGAAAAGGGCCAAGAGTTCAGG - Intergenic
916864366 1:168839290-168839312 AAGAGAAGGAAGCAGTGTTCAGG - Intergenic
916958859 1:169868871-169868893 AAGAGCAGGCAGCAGTGTTCCGG + Intronic
917450274 1:175142239-175142261 CAGAAAAAGCAGGAGGATTCTGG - Intronic
918086304 1:181248025-181248047 CAGAAGAGGCAGAAGCATACTGG - Intergenic
920261816 1:204693455-204693477 CATGAAAGGCAGAAGAGTTGTGG - Intergenic
922051499 1:221994812-221994834 TAGAAGAGTCAGAAGAGTTCTGG + Intergenic
922966581 1:229695956-229695978 CAGAGAAGGCAGCACAGTTCAGG + Intergenic
924117006 1:240757811-240757833 CACAAAAGGAAAAAATGTTCTGG - Intergenic
1065757951 10:28951553-28951575 GAGAAAAGCCACAAGTGTTAAGG + Intergenic
1066255247 10:33672391-33672413 GGGAAAAGGGAGAAGTTTTCAGG - Intergenic
1066789195 10:39044214-39044236 CAGAAGAGGCAGAAGCATACTGG - Intergenic
1067211509 10:44263433-44263455 GAGAAAAGGCAGAAGTGATGGGG - Intergenic
1068361159 10:55976120-55976142 AATAAAAGGTAGAAGTTTTCAGG - Intergenic
1068709223 10:60114979-60115001 CAGAAAAGCCAGGAGAGTTTTGG + Intronic
1069891346 10:71654400-71654422 CAGCAAAGGCTGAAGTGCTGGGG + Intronic
1070467901 10:76742962-76742984 CAGAAAAGGCAAAACTGTATTGG - Intergenic
1070963016 10:80512114-80512136 CACAAAAGCCAGAACTGTTAGGG - Intronic
1071499624 10:86194076-86194098 CAGAGAAAGGAGAAGTGTTCTGG - Intronic
1073071736 10:100798690-100798712 TAGAAAAGGAAGGAGTGTTCAGG - Intronic
1073354473 10:102843094-102843116 CAGAAGAGGCAGAAGCATACTGG + Intergenic
1073428307 10:103469781-103469803 CAGACAAGGCAGGAATGTACTGG - Intergenic
1075717722 10:124566640-124566662 CCCAAAAGGCAGACGTGTGCTGG - Intronic
1077068917 11:658585-658607 CACAAAGGGCAGAAGTGCCCAGG + Intronic
1079144760 11:17840798-17840820 CAGCAAAGCCAGATGGGTTCTGG + Intronic
1079236343 11:18693383-18693405 CAGAAAGGGCAGAAGGGACCTGG + Intronic
1079754012 11:24233470-24233492 CTTACAAGGCAGAAGTGATCTGG - Intergenic
1080870021 11:36228961-36228983 CAGAAAAGGCCAGTGTGTTCTGG - Intronic
1081016013 11:37881889-37881911 CAGAAAATGCAGGCGTGTTTTGG - Intergenic
1081016068 11:37882678-37882700 CAGAAAATGCAGGCGTGTTTTGG - Intergenic
1082580110 11:54855746-54855768 GATAAAAGGCAGAAGTGGCCAGG - Intergenic
1083237687 11:61362104-61362126 CAGAGGAGGCGGAAATGTTCAGG + Exonic
1083808036 11:65086752-65086774 CAGAGAAGTCAGACGTGTTGAGG - Exonic
1084773419 11:71358766-71358788 CAGAAAAGGCAGTGGTGAGCAGG + Intergenic
1086589571 11:88496100-88496122 AAGAGCAGGCATAAGTGTTCTGG - Intergenic
1086853800 11:91842571-91842593 CAGCAAAGGCAGCAGTGTGGAGG - Intergenic
1086855496 11:91860559-91860581 GAGAAGAGCCAGAAGTATTCAGG + Intergenic
1087470802 11:98571802-98571824 CAGAAAAGGCAGAACTGATCTGG - Intergenic
1087681104 11:101219339-101219361 CAGAAGAGGCAGAAGTATACTGG + Intergenic
1088122822 11:106389915-106389937 CAAAAATGTCAGAAGTGTTGAGG - Intergenic
1088711233 11:112510811-112510833 CATCAAAGGCAGAAGTGGTGTGG + Intergenic
1089844198 11:121445637-121445659 CAGAGAAGGCTAAAGTGCTCTGG - Intergenic
1093227621 12:16504505-16504527 CAGAAAGGGTAGAAGTTTACTGG - Intronic
1094045086 12:26158619-26158641 CAGAAGAGGCAGATGAGTCCTGG + Intronic
1094050505 12:26215431-26215453 CAGAAAAGGCAGAAATGGGGTGG + Intronic
1094415920 12:30214733-30214755 CTGAATAGTCAGAAATGTTCAGG - Intergenic
1095850086 12:46792952-46792974 CAGAAAAGGCAGCAATGAGCAGG - Exonic
1097664872 12:62467014-62467036 GAGAAAAGCCAGAGGTGTTGCGG + Exonic
1099205448 12:79721385-79721407 CAGAAAAGGCAGAAGGGGCTAGG - Intergenic
1099592090 12:84606348-84606370 CTAAAAAGTCAGAAGTTTTCCGG - Intergenic
1100441658 12:94622864-94622886 CAGTAAATACAGAAGTGTTGAGG - Intronic
1100445599 12:94656930-94656952 CATAAAAGGCCGAAGAGTACAGG + Intergenic
1101791234 12:107929756-107929778 CAGAAAAGCCATAAATATTCTGG + Intergenic
1103243542 12:119435407-119435429 TGGAAAAGGCAGAAGTTATCAGG - Intronic
1103342090 12:120226100-120226122 CAGAAAAGGAACCAGTGTCCAGG + Intronic
1103861387 12:124017268-124017290 CAGAATATGCAGAAATCTTCAGG + Intronic
1104871899 12:132005557-132005579 CAGGAAAGGCAGACCTTTTCTGG - Intronic
1105402097 13:20105045-20105067 CAGACAAGGGAGAAGTGCACGGG + Intergenic
1105595602 13:21834806-21834828 CAGAAAATGCAGCAGAGTTGTGG + Intergenic
1107015096 13:35701960-35701982 CAGAAAAGGCAGAGGGGAACAGG - Intergenic
1108829256 13:54456479-54456501 CAGAAAATTCATGAGTGTTCAGG - Intergenic
1109535749 13:63717009-63717031 TAGAAAAGAGAGTAGTGTTCAGG + Intergenic
1109540352 13:63769277-63769299 TAGAAAAGAGAGTAGTGTTCAGG - Intergenic
1112695547 13:101944135-101944157 CAGAAAGAGCAGAAGTTTTATGG + Intronic
1113323134 13:109256790-109256812 CAGAAAATGCAGAGGTCCTCAGG - Intergenic
1113487613 13:110665825-110665847 CATTAAATGCAGAAGTGCTCCGG - Intronic
1114017965 14:18449222-18449244 CAGAGACGACAGCAGTGTTCCGG + Intergenic
1114019438 14:18464093-18464115 CTGAGATGGCAGCAGTGTTCTGG + Intergenic
1114023247 14:18500334-18500356 CAGAACCTGCAGCAGTGTTCTGG - Intergenic
1114024424 14:18511968-18511990 CAGAAACAGCAGCAGTGTTCTGG - Intergenic
1114975346 14:28089842-28089864 CAGAAAAGAAGGAAGTGTTTAGG - Intergenic
1115284537 14:31702862-31702884 AAGAAAAGGAAGAAATGTTTAGG - Intronic
1115328641 14:32169685-32169707 AAGAAAACTCAGAATTGTTCTGG + Intergenic
1116703758 14:48269449-48269471 CAGAAAAGGCAGGAGAGATATGG + Intergenic
1116790765 14:49337519-49337541 AAGCAAAGGAAGAAGTGGTCAGG - Intergenic
1116942491 14:50804296-50804318 CAGAAAAAGCAGAGATGCTCAGG + Intronic
1117060928 14:51962698-51962720 CAGAAAAGGGAGAGATTTTCTGG + Intronic
1118487477 14:66227501-66227523 CAGAAAAGGCACAAGTCTTGGGG - Intergenic
1119734978 14:76976037-76976059 CAGAGAAGGGAGGAGTGTGCAGG + Intergenic
1119756298 14:77122255-77122277 CAGAAGAAGGAGAAATGTTCGGG - Intronic
1120391021 14:83908840-83908862 TAAAAAAATCAGAAGTGTTCTGG + Intergenic
1120917676 14:89723957-89723979 CAGCAAAGGTAGCAGTGTGCTGG - Intergenic
1121342360 14:93113135-93113157 CAAAGAAGGCAGAAGTCATCAGG - Intronic
1121486636 14:94321469-94321491 GAGAAAAGGCTGATGTGTGCTGG - Intronic
1121506789 14:94483786-94483808 AATAAAAGCCACAAGTGTTCGGG + Intergenic
1121929410 14:97958751-97958773 CAGAAAAGGGAGACGTGCTATGG + Intronic
1125496786 15:40203341-40203363 CAGAATAGGCAAAAGTGTCATGG + Intronic
1125649431 15:41302507-41302529 CACAAAAGGAAAAAATGTTCTGG + Intergenic
1128226539 15:66005520-66005542 CAAAAAAGGCAGGAGTGTGGAGG + Intronic
1128719581 15:69938495-69938517 GAGAAAAGGGAGAACTTTTCAGG - Intergenic
1129605420 15:77022722-77022744 CAAGAAAGGGAGGAGTGTTCTGG + Intronic
1129648483 15:77461062-77461084 CAGAAAAGCCAGAAGAGTGAAGG + Intronic
1132377386 15:101338492-101338514 AAGAACAGGCAGATGTGTCCAGG + Intronic
1132383337 15:101381941-101381963 GAGAAAACGCAGACGTGTGCAGG + Intronic
1133119088 16:3595374-3595396 CAGAAAAGGCAGAAGTCTCGTGG + Intronic
1134066947 16:11234313-11234335 CTGAAAAGGCAGAAGCCTCCAGG + Intergenic
1135224170 16:20641169-20641191 CAGAAAAGGCTGATGTGAACAGG + Intronic
1137826828 16:51505090-51505112 CAGAAGTGGCAGGAGTGTTGTGG - Intergenic
1139516695 16:67456661-67456683 CTGAAAAGGAAGAAGTCTCCTGG - Intronic
1141847435 16:86620274-86620296 AACACAAGGCAGAAGTCTTCTGG + Intergenic
1147477026 17:40721827-40721849 CAGTAGAGGCAGATGTGGTCTGG - Intergenic
1147887575 17:43694809-43694831 CACAAAAGGCAGAATTATTAAGG + Intergenic
1148630876 17:49107815-49107837 CAACAAAGTCAGAGGTGTTCTGG + Intergenic
1148876613 17:50691064-50691086 CAAAAAAGAGAGAAGTGGTCAGG - Intronic
1148907648 17:50921361-50921383 CAGAGAAAGCAGAAGTGTGGAGG - Intergenic
1149925793 17:60700843-60700865 CAGAAATGGGAGGAGTGTTAGGG + Intronic
1150319368 17:64199144-64199166 CAGAAAATGCAGACTTGTCCAGG + Intronic
1151035552 17:70794664-70794686 CAGGTAAGGCAGAAATGTTCTGG + Intergenic
1152390687 17:80002061-80002083 CAGGAAACGCAGAAGGGATCCGG + Intronic
1203156451 17_GL000205v2_random:8425-8447 CAGAACCAGCAGCAGTGTTCTGG + Intergenic
1203156698 17_GL000205v2_random:10771-10793 CAGACACAGCAGGAGTGTTCTGG + Intergenic
1153925018 18:9827952-9827974 CAGAAAGGACAGAGGGGTTCAGG + Intronic
1154289695 18:13096675-13096697 AAGAAATGGCAGAAGTGTTTGGG - Intronic
1155075539 18:22350815-22350837 CATAGGAGGCAGAAGTGTACAGG - Intergenic
1155493485 18:26421681-26421703 CAGAAAAGCCTGAGGTGGTCAGG + Intergenic
1155555502 18:27014743-27014765 CAGAAAAGGGGGAATTTTTCTGG + Intronic
1156394245 18:36683757-36683779 CAGCAATGGCAGCAGTGTCCAGG + Intronic
1156925278 18:42569954-42569976 CTGAAAAGGCAGATGTGTGGAGG - Intergenic
1158397842 18:57093628-57093650 CAGACATGGCAGGAGTGTCCTGG - Intergenic
1162453035 19:10766156-10766178 CAGAAAAGACAGCAGGGTTTGGG - Intronic
1162991490 19:14305538-14305560 TAGAAAAGCCAGAAGAGGTCGGG - Intergenic
1163692409 19:18744956-18744978 CAGAGAAGGCATAAGGGCTCAGG + Intronic
1163927995 19:20363543-20363565 CAGAAAAGGCAGGACTGTTGTGG - Intergenic
1164289620 19:23855686-23855708 CAGAAGAGGCAGAAGCATACTGG + Intergenic
1165113175 19:33513796-33513818 CGGCAAAGGCTGGAGTGTTCTGG - Intronic
1165707536 19:37987221-37987243 CTGAAAAAGCAGATGTGTCCGGG - Intronic
1167749448 19:51371012-51371034 CAGAAAAGTCAGGAGTCTTGTGG - Intergenic
926006408 2:9376391-9376413 CAGAAAAGGCAGTGGAGTTGGGG + Intronic
927349218 2:22088128-22088150 CAGAAAAGGCTTATGAGTTCAGG - Intergenic
928369407 2:30730367-30730389 CAGAAATGGTAGAAATGGTCAGG - Intronic
929062247 2:37934341-37934363 CAGAAAAGGCATAAGTGCATAGG - Intronic
929087081 2:38178917-38178939 ATGAGAAGGCAGATGTGTTCTGG + Intergenic
929570591 2:43020544-43020566 GAGAAAAGGGAAAATTGTTCTGG + Intergenic
929696363 2:44119624-44119646 CAATAACAGCAGAAGTGTTCTGG + Intergenic
929874380 2:45784355-45784377 CAAAAAAGGAAGAAGTGGGCTGG + Intronic
931187064 2:59963340-59963362 CAGAAAAGACACCAGTGCTCAGG - Intergenic
931213371 2:60218475-60218497 CAGTAAAGTCAGAGATGTTCAGG + Intergenic
931553777 2:63476975-63476997 CTGAAAATGCAGAATTGTTATGG + Intronic
931623173 2:64231383-64231405 CAGAGAAGTCAGAAGACTTCAGG - Intergenic
933014975 2:77113653-77113675 CAGAAGAGGCAGAAGTGCACTGG + Intronic
935893439 2:107705965-107705987 TAGAAAATGCAGAATAGTTCAGG + Intergenic
936274757 2:111085177-111085199 CAGAAAAAACAAAAGTATTCAGG + Intronic
936437265 2:112519129-112519151 CAGAAATGGCATAGGTTTTCTGG + Intronic
937380529 2:121372629-121372651 CAGAAGAATCAGAAGTCTTCTGG - Intronic
937674656 2:124576892-124576914 CAGAAAATGTAGAAGTGTAGAGG - Intronic
937861912 2:126718089-126718111 AAGATCAGGGAGAAGTGTTCTGG - Intergenic
939836916 2:147140976-147140998 CAGAAAAGGCAAAAGTATAAGGG + Intergenic
941225617 2:162843167-162843189 CAGAAGAGGCAGAAATTTTTAGG + Intergenic
943122975 2:183760548-183760570 CAGGAAAGTCAGAAATGTCCAGG - Intergenic
943452831 2:188066407-188066429 CAGAAAAGACAGTAGTTTCCAGG + Intergenic
943528419 2:189048093-189048115 CAGAAAAATCAGAAGTGTATTGG + Intronic
944595560 2:201257678-201257700 GAAAAAAGGAGGAAGTGTTCTGG - Intronic
945868193 2:215200114-215200136 CAGAAAAAACAGAAGTTTTGAGG + Intergenic
945959152 2:216114282-216114304 CAGAAGAAACAGAAGTGTCCAGG - Intronic
946357736 2:219199143-219199165 CAGAAAAGGCAGGAGGTATCTGG - Intronic
1169621662 20:7513728-7513750 CAGATATTGCAGAAGTTTTCTGG + Intergenic
1169920025 20:10725547-10725569 GAGAAAAAGCAGAAGTGAACAGG - Intergenic
1169947005 20:10999777-10999799 CAGAACTGGCAGAAGTGGACAGG - Intergenic
1170468798 20:16647854-16647876 CTGAAAAGGCAAAACTATTCAGG + Intergenic
1172357807 20:34292041-34292063 CAGGAATGGCTGGAGTGTTCAGG - Intronic
1172468395 20:35173872-35173894 CAGAAAAGGCAGCAGGGGCCAGG + Intronic
1173189956 20:40868648-40868670 CAGAAAATGCACCAGTGTGCGGG + Intergenic
1173283120 20:41646963-41646985 AAGAGAAGGCAGAAGGGTTGGGG + Intergenic
1173356717 20:42299940-42299962 CATAAAAGGCAAAAGTGGCCGGG - Intronic
1174466704 20:50723359-50723381 GAGAAAAGGAAGAGGTGTTCTGG - Intergenic
1174670989 20:52307543-52307565 CAGAAAAAGCAGAAGGGTGGGGG - Intergenic
1175273505 20:57751559-57751581 CAGACAAGGCAGAAGCTCTCTGG - Intergenic
1175867063 20:62184522-62184544 CAGGGAAGGCAGCAGTGATCGGG + Intronic
1178119987 21:29459842-29459864 CTGAAATGGCAGAAGTCCTCAGG - Intronic
1180442474 22:15380092-15380114 CAGAGACGACAGCAGTGTTCCGG + Intergenic
1180443940 22:15394918-15394940 CTGAGATGGCAGCAGTGTTCTGG + Intergenic
1180447350 22:15427290-15427312 CAGAACCTGCAGCAGTGTTCTGG - Intergenic
1180448590 22:15439495-15439517 CAGAAACAGCAGCAGTGTTCTGG - Intergenic
1180522623 22:16223884-16223906 CAGATCCAGCAGAAGTGTTCTGG + Intergenic
1180922478 22:19528201-19528223 CAGGAAAGGCAGAAGAGAACCGG - Intergenic
1180991096 22:19936702-19936724 CAGAAGAGGCAGAAGCATACTGG - Intronic
1181377139 22:22468433-22468455 ATGCAAAGGCAGAAGTGTTACGG + Intergenic
1181543489 22:23587354-23587376 CAGAAATGGAAGCAGGGTTCTGG - Intergenic
1182504890 22:30774519-30774541 CTTAAAAGGCAGAAATGTTTAGG - Intronic
1184112183 22:42401905-42401927 AAGATAAGGCAGAAGTGGCCAGG - Intronic
949469112 3:4375963-4375985 CAGAAAATCCAGAAATGTACAGG + Intronic
950330928 3:12155592-12155614 TAGAGAGGGCAGCAGTGTTCTGG + Intronic
950603083 3:14052714-14052736 CAGAAAAGGCAGAAGTGTTCAGG - Intronic
950666376 3:14497764-14497786 AAGAAAAGACAGTGGTGTTCTGG + Intronic
952414311 3:33076487-33076509 CAAAAAAGGCAGAAGAGATGTGG + Intronic
955225436 3:57056495-57056517 GAGAAGGGGCAAAAGTGTTCTGG + Intronic
955507581 3:59647483-59647505 CAGCAAAGGTAGTGGTGTTCTGG - Intergenic
960815134 3:121664248-121664270 CAGATTAAGCAGAAGCGTTCAGG + Exonic
961424218 3:126832312-126832334 AAGAAAAGGCAGTAAGGTTCTGG - Intronic
961792774 3:129388408-129388430 CACAGAAGGAAGAAGTGTGCAGG + Intergenic
963764506 3:149320177-149320199 GGGAAATGGCAGAAGTGTTGAGG + Exonic
964129769 3:153273573-153273595 CAGAAAAGGAAGGAGTGTCCTGG - Intergenic
966264980 3:178029108-178029130 CAGGAAAGACATAAGTGTTGGGG - Intergenic
966854129 3:184182630-184182652 CAGAACAAGGAGAAGTGGTCAGG - Intronic
966883525 3:184362466-184362488 CAGGAAACGCACAAGTGTGCGGG + Intronic
967576532 3:191101270-191101292 AAGAAAAGCCAGAAGAGCTCAGG + Intergenic
968726590 4:2250747-2250769 CAGAAAAGGGAGAAATGGGCTGG - Intronic
969477426 4:7429558-7429580 CAGAAAAGACAGAGGTGTCATGG + Intronic
971508327 4:27391158-27391180 AAGAAAAGACAGAAATGTGCAGG - Intergenic
972828360 4:42787018-42787040 GAGAAACGACTGAAGTGTTCAGG + Intergenic
973805088 4:54518017-54518039 CAGAGAAGCCAGCTGTGTTCTGG + Intergenic
973900651 4:55466687-55466709 CAGGAGAGGCAGAATTGTTGGGG - Intronic
975725201 4:77284989-77285011 CAGAAAGGGAACAAGTGTCCTGG - Intronic
976437752 4:85038004-85038026 CAAATAAAGCAGAAGTGTTCAGG - Intergenic
978276393 4:106955914-106955936 CAGTAAAGGTAAAAGAGTTCAGG - Intronic
978970074 4:114792983-114793005 CAGAAAAGTTCGAATTGTTCTGG + Intergenic
979871370 4:125826791-125826813 CAGATAAGGTAGAAATGTACAGG - Intergenic
980314855 4:131185592-131185614 CAGAAGAGGCAGAAGAGATAAGG + Intergenic
980841631 4:138268369-138268391 TAGAAAAGGAATAAGTGCTCTGG - Intergenic
982455390 4:155603611-155603633 CAGCTAAGGCAGAAGTGTCCAGG + Intergenic
982483583 4:155940316-155940338 CAGAAAAGGCAGAAGAGAGTAGG + Intronic
982576369 4:157115270-157115292 CAGAAATTAAAGAAGTGTTCAGG - Intronic
982821416 4:159944594-159944616 CAGAAAAGGCAGATTTGTTCTGG + Intergenic
984226663 4:177043653-177043675 CAGTGAAAGGAGAAGTGTTCTGG + Intergenic
984863729 4:184262968-184262990 CAGAAAAGTCAGAAGAATTAGGG + Intergenic
985091263 4:186364649-186364671 AAGAAAAGGCAATAGTGTTGAGG - Intergenic
985200412 4:187478865-187478887 CAGAAATGGCTGATGTTTTCAGG - Intergenic
986803496 5:11285451-11285473 AAGACAAGGGAGAAGAGTTCTGG + Intronic
988017057 5:25572553-25572575 CAGAAAAGGTAAAAATGGTCTGG + Intergenic
990532336 5:56686924-56686946 CTGCAAAGGCAGAAATGTGCTGG - Intergenic
991226508 5:64279339-64279361 AAGAATAGACAGAAGTGATCAGG + Intronic
991660941 5:68950066-68950088 CAGAGAATACATAAGTGTTCTGG + Intergenic
994218597 5:97167817-97167839 CAGAAAAAGCAGAGGTTTACGGG - Exonic
994350482 5:98739454-98739476 AATAAAAGGCAGAGGTTTTCAGG + Intergenic
995113171 5:108450384-108450406 AAGAAAAGGCAGATTAGTTCAGG - Intergenic
997152688 5:131515770-131515792 AGGAAAAGGCAGACATGTTCAGG + Intronic
998945481 5:147335358-147335380 CAGAAAATCCAGATGTGTGCTGG + Intronic
998968241 5:147563836-147563858 TTGGAAAGGCAGAAGTGTGCAGG - Intergenic
999091287 5:148938423-148938445 CAGAAGAGGCTCAAGTGTTTTGG - Intronic
1001299857 5:170525697-170525719 GAGGACAGGCAGGAGTGTTCTGG + Intronic
1004054891 6:12125672-12125694 CAGTATAGGCTGAAGTTTTCTGG - Exonic
1004601417 6:17153970-17153992 CAGAGAAAGCAGAAGCGTTTGGG - Intergenic
1005084202 6:21987390-21987412 CAAAAAAGGCAGAAATGCTAAGG - Intergenic
1006742319 6:36318151-36318173 CAAGAAAGACAGAAGTGTTTCGG + Intronic
1007164437 6:39819036-39819058 CAAAACTGGCAGAATTGTTCTGG + Intronic
1007416268 6:41693178-41693200 CAGCAAAGGCTGACATGTTCTGG + Intronic
1007486444 6:42184066-42184088 AAGAAAAGGCAGGAGTTTTGGGG - Intergenic
1008662600 6:53683498-53683520 CAGGAAAGGCAGAAAAGTTGTGG + Intergenic
1009360594 6:62806769-62806791 CAGACAAAGCAAAAGTTTTCAGG + Intergenic
1011555393 6:88567279-88567301 CAGAAAACGCAGAGGTGTGCTGG - Intergenic
1013590801 6:111618324-111618346 GAGAAAAGGTAGAATTGTTGTGG - Intergenic
1014265782 6:119275794-119275816 CAGAAAAGGAAGAAAAGTTGTGG + Intronic
1014279845 6:119429582-119429604 TAGAATAGGCAGAAGTGGTTGGG + Intergenic
1014917511 6:127169453-127169475 CAGCACAGGCAGAAGAGTTTAGG - Intronic
1015170673 6:130249045-130249067 CAGGAAAGAGAGAGGTGTTCTGG - Intronic
1018357130 6:163029476-163029498 GAGGAAAGGGAGAAGTGTGCTGG - Intronic
1019787599 7:2987284-2987306 ATGAAAAGGCAGAGGTGATCGGG + Intronic
1021134196 7:16945641-16945663 GAGAAAAGGCAGAAATATCCTGG + Intergenic
1021153985 7:17186670-17186692 GAGAAAAGCCAGCAGTTTTCAGG - Intergenic
1021155978 7:17210344-17210366 CAGAAAAGGTAGAAATACTCTGG - Intergenic
1021314165 7:19125713-19125735 CAGAAAAGGAAGAGTTGCTCTGG - Intergenic
1021651073 7:22833860-22833882 CACAAAAGGCTGAAGAGTTCAGG + Intergenic
1023481380 7:40638559-40638581 CAGAAAAGTCAGAATGTTTCTGG - Intronic
1025966825 7:66280925-66280947 CAGAACATGCTGAAATGTTCTGG - Intronic
1027952179 7:84830900-84830922 CAGAAAAGACAGAAGTGCTCAGG + Intergenic
1029905828 7:104092744-104092766 CAAAACAGGCAGAACTATTCTGG - Intergenic
1031327587 7:120421384-120421406 GTGAAAATGCAGAAGTGTCCTGG - Intronic
1031489010 7:122364877-122364899 GACACAAGGCAGAAGTGTTATGG + Intronic
1031889938 7:127282308-127282330 AAGCAAAGACAGAAGAGTTCTGG - Intergenic
1032939046 7:136767758-136767780 CACCAAAGGCTGAAGTGTTCTGG + Intergenic
1033907156 7:146219093-146219115 CAGGAAAGACAGAAAAGTTCAGG + Intronic
1034350419 7:150411527-150411549 CAGAAAAGGCAAAACTGACCAGG + Intronic
1035613962 8:988800-988822 CAGAAAAAGCAGGATTGGTCAGG - Intergenic
1035633291 8:1125083-1125105 CAGAGAAGGCAGAGGTCTTATGG - Intergenic
1035722989 8:1806359-1806381 AAGAGGAGGCAGAAGTGTTCAGG + Intergenic
1040352446 8:46582642-46582664 CAGAAAGAGCAGAAGTATACTGG - Intergenic
1040491475 8:47927194-47927216 CTGACAAGGCTGAAGTCTTCAGG + Exonic
1040737449 8:50526167-50526189 CAGAGAACACAGAAGAGTTCAGG - Intronic
1040768952 8:50950123-50950145 CAGAACAGCCAGAAGTACTCTGG + Intergenic
1041079418 8:54202369-54202391 CTGGAAAGGCAGGACTGTTCTGG + Intergenic
1041472547 8:58226383-58226405 CAGAAAAGGCAGAAGGAATAGGG - Intergenic
1044012939 8:87017120-87017142 CAGAAAAGGTAAAATTGGTCTGG + Intronic
1044130349 8:88515760-88515782 CAGAAAAGACAGGAGTGTCTAGG + Intergenic
1044536402 8:93361166-93361188 CAGATATGGCAGAAGTTTTGGGG - Intergenic
1044710136 8:95049203-95049225 CAAAAAAAGAAGAAGAGTTCAGG - Intronic
1044722703 8:95166375-95166397 TAGAAAATGAAGAAGGGTTCTGG + Intergenic
1045455947 8:102379008-102379030 CAAAAAAGGCAGCAGTATTGGGG - Intronic
1045590635 8:103591047-103591069 CAAAAAAGGTATAAGAGTTCTGG + Intronic
1045757937 8:105568052-105568074 AAGAAAGGCCAGAAGTGTTTTGG - Intronic
1046562627 8:115857367-115857389 AAGGAAAGGCAGAATTGTTTTGG + Intergenic
1047566212 8:126046903-126046925 CAGAAAGGGCAGAATGGCTCAGG + Intergenic
1048013966 8:130481446-130481468 CAGTACAGGCAGAAGTGCTGAGG + Intergenic
1048379066 8:133847897-133847919 CAGAGAAGGCAGCAGAGCTCTGG + Intergenic
1050731356 9:8713464-8713486 AAGAAAATGAAGAAGTCTTCAGG + Intronic
1052421627 9:28250482-28250504 TAGAAAAGGCTGACTTGTTCGGG - Intronic
1052552262 9:29967266-29967288 CAGAAGAGGGAGAAGGGTTTTGG - Intergenic
1052687337 9:31772567-31772589 CAGAAGAGGCAGAAGCATACTGG - Intergenic
1053483898 9:38437584-38437606 CTGAATAGTCAGCAGTGTTCTGG + Intergenic
1055610621 9:78020599-78020621 CAGAAGAGGCAGCATTGGTCTGG + Intronic
1056331467 9:85524490-85524512 CAGAAAAGGCAGAAGAGAGGTGG - Intergenic
1057226233 9:93294733-93294755 TAGAAATGGCAGAAGTGATTGGG + Intronic
1057444821 9:95106197-95106219 CAGAAAGGGCATGAGTGGTCAGG - Intronic
1058800445 9:108540260-108540282 CAGAAAGGGCAGGAGTCTCCAGG - Intergenic
1059199109 9:112398131-112398153 CAGAAAAGGCATAAGCATACTGG + Intronic
1059974868 9:119705138-119705160 CAGAGAAGGCATAAGTATTTGGG + Intergenic
1060027436 9:120185016-120185038 AAGAGAAGGCAGAACTGTTTGGG - Intergenic
1060172294 9:121471788-121471810 CAGAAAAGGCAGATGGCTGCAGG + Intergenic
1060433079 9:123567518-123567540 TAGAAAAGGCATTAATGTTCTGG - Intronic
1062295687 9:135824937-135824959 CAGCAAATGCACAAGTGTACAGG + Intronic
1203494549 Un_GL000224v1:138756-138778 CAGAACCCACAGAAGTGTTCTGG - Intergenic
1203507168 Un_KI270741v1:80631-80653 CAGAACCCACAGAAGTGTTCTGG - Intergenic
1185583742 X:1229897-1229919 TAGAAAAGGCAAAACTGTCCGGG - Intergenic
1185829705 X:3288919-3288941 CAAAAAAGGCAGAAGTGGAGGGG + Intergenic
1188042141 X:25381007-25381029 CTGAAAAGGGAGCAATGTTCAGG + Intergenic
1188839234 X:34994828-34994850 CAGAAAAGGCAAAACTGTGGAGG - Intergenic
1188945872 X:36301086-36301108 CTGAAATGGCTGAAGAGTTCTGG + Exonic
1190752599 X:53375253-53375275 CAGGACAGGCAGAGGTGGTCAGG - Exonic
1190777035 X:53561149-53561171 CAGAAAACACTGAACTGTTCTGG - Intronic
1191101240 X:56730636-56730658 GAGAAAAGGCAGAATTCTTCTGG + Intergenic
1191648112 X:63506043-63506065 TAGAAAAGGCTGAAGTTCTCTGG - Intergenic
1191665942 X:63702765-63702787 CAGAAAATGCAGAAGTAGCCTGG + Intronic
1193169730 X:78321699-78321721 AAAAAAAGGCATAAGTGGTCTGG + Intronic
1194564679 X:95470041-95470063 CAGAGAAGGCAGGAGTGATGTGG + Intergenic
1194686332 X:96922365-96922387 CAAAAAAGAAAGAAGTGTTGAGG - Intronic
1198044371 X:132886041-132886063 CAGAAAAGTGAGATGTGCTCAGG + Intronic
1198175867 X:134153847-134153869 AAGAAAAGGGAGAAGAGTTAAGG + Intergenic
1198541402 X:137643891-137643913 CAGAAAGGGAAGACATGTTCAGG + Intergenic
1200049706 X:153422297-153422319 CAGACAAGGCGGGAGTTTTCTGG - Intergenic