ID: 950604780

View in Genome Browser
Species Human (GRCh38)
Location 3:14068932-14068954
Sequence ATGTCCTTCCTATAGAGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 132}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950604776_950604780 18 Left 950604776 3:14068891-14068913 CCTCTTTTATTCTAAACCATGGA 0: 17
1: 21
2: 24
3: 47
4: 248
Right 950604780 3:14068932-14068954 ATGTCCTTCCTATAGAGTGAAGG 0: 1
1: 0
2: 0
3: 14
4: 132
950604778_950604780 2 Left 950604778 3:14068907-14068929 CCATGGAAAAAGGACCTAACAAA 0: 39
1: 40
2: 27
3: 29
4: 254
Right 950604780 3:14068932-14068954 ATGTCCTTCCTATAGAGTGAAGG 0: 1
1: 0
2: 0
3: 14
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950604780 Original CRISPR ATGTCCTTCCTATAGAGTGA AGG Intronic
903417416 1:23193504-23193526 AAGCGCTTCCCATAGAGTGAGGG + Exonic
906835267 1:49076639-49076661 ATGTGCTTCCTAGAGAATGATGG + Intronic
907868068 1:58418001-58418023 CTTCCCTTCCAATAGAGTGAAGG - Intronic
912062500 1:105690093-105690115 ATTTCCTTCCTATAAAGTCTTGG + Intergenic
917658200 1:177148677-177148699 TTTTCCTTCCTATAAAGAGATGG + Intronic
918365501 1:183803949-183803971 ATCTCCTCTCTATACAGTGATGG + Intronic
918465314 1:184815818-184815840 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
921082495 1:211753973-211753995 ATTTCCTGCTTAGAGAGTGAAGG + Intronic
1063009903 10:2011827-2011849 ATCTCCTCCCTATACAGTGGAGG + Intergenic
1063322745 10:5066958-5066980 ATGCCCTTCTAAAAGAGTGAAGG + Intronic
1065346811 10:24756369-24756391 ATGTTCTTCCAATAGAATGCAGG + Intergenic
1065807216 10:29405324-29405346 ATGTCCTTCTGTAAGAGTGAAGG + Intergenic
1068320469 10:55407387-55407409 ATGTCCTTTACATAGAGAGATGG + Intronic
1068466745 10:57403046-57403068 ATGTCCTCCCTATTGAGTGGGGG + Intergenic
1070397068 10:76020558-76020580 ATGTCCTCACCTTAGAGTGAGGG - Intronic
1072322780 10:94267089-94267111 ATTTCATTCCTATAGAATAATGG - Intronic
1072479599 10:95797891-95797913 ATGTCATTCCTATAGAGGTTGGG + Intronic
1072779838 10:98241162-98241184 ATTCCCTTCTTTTAGAGTGACGG - Intronic
1073886180 10:108042628-108042650 ATCTTCTTCCTACAGAGTCATGG + Intergenic
1074014361 10:109518726-109518748 ATTTCCTGCCTATAGAGTTTTGG + Intergenic
1075511263 10:123074500-123074522 TTCTCCTCCCTATAGAGAGAAGG - Intergenic
1076025988 10:127113861-127113883 ATGTCCATCCTGCAGAGTGTGGG - Intronic
1076349485 10:129806098-129806120 ATCTTCTTCCTCTAGAGTGGGGG - Intergenic
1078311813 11:10251260-10251282 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1080963408 11:37186410-37186432 TTGTCCTGCCTACAGAGGGAAGG - Intergenic
1082698362 11:56398723-56398745 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1085786162 11:79452082-79452104 TTGACCTTCCTATAGACTGGTGG - Intergenic
1087226903 11:95611422-95611444 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1088261578 11:107949005-107949027 ATGTTCTTCCTATTGAGAGTTGG - Intronic
1088361390 11:108993764-108993786 ATGTCTTGCCTATAAAATGAAGG - Intergenic
1090292885 11:125561329-125561351 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1090828956 11:130407685-130407707 ATGTACTTCCTGCAGAGTAAGGG - Intronic
1092373065 12:7933222-7933244 ATTTCCTTCCTAGAGAATCAAGG + Intronic
1097254578 12:57663910-57663932 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1098660824 12:73091421-73091443 ATTTCCTTCCTATTGAATAAAGG - Intergenic
1099885955 12:88530699-88530721 ATGTCTATCCTATTGAGTTAGGG - Intronic
1101189409 12:102315861-102315883 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1105869532 13:24491962-24491984 CTGTACTTCCTGTAGAGTGACGG - Intronic
1110050158 13:70886918-70886940 ATGTCCTTTTAATAGAATGAAGG - Intergenic
1110563402 13:76934011-76934033 ATGTCCTTCCGACAGAGGAAGGG - Intergenic
1112320319 13:98400778-98400800 CTGGCCTTCCTCTAGTGTGATGG + Intronic
1112664807 13:101557542-101557564 GTTTCCTTCCTCTACAGTGAGGG + Intronic
1113968453 13:114168849-114168871 ATGCCCTTCCAGAAGAGTGAAGG + Intergenic
1114528121 14:23378890-23378912 ATGTGCTTCATATTGTGTGAGGG + Intronic
1115006366 14:28490049-28490071 ATGTCCATCCAAAAGAATGATGG + Intergenic
1117657828 14:57974441-57974463 ATGTTCTTCCTATTGAGAGATGG - Intronic
1129850162 15:78789273-78789295 GTGTGCTTCCCATAGATTGAGGG - Intronic
1130252099 15:82306303-82306325 GTGTGCTTCCCATAGATTGAGGG + Intergenic
1131362182 15:91803057-91803079 ATGGCCTTCCTGCAGAGGGACGG + Intergenic
1133438386 16:5800075-5800097 ATGTCCTACTTATAGATGGAGGG + Intergenic
1134557454 16:15177777-15177799 AGGGCCTTCCTCTAGATTGAGGG + Intergenic
1134918023 16:18089456-18089478 AGGGCCTTCCTCTAGATTGAGGG + Intergenic
1136280448 16:29205786-29205808 ATGTCCTTCCTGCTGTGTGATGG + Intergenic
1141164107 16:81648862-81648884 TTGACGTTCCTAAAGAGTGAGGG - Intronic
1142084815 16:88171744-88171766 ATGTCCTTCCTGCTGTGTGATGG + Intergenic
1147476322 17:40715113-40715135 ATGTCATTCTTATATACTGATGG + Intergenic
1147532930 17:41297343-41297365 ATATCCTTCCTCTAGCATGATGG + Intergenic
1148957485 17:51365736-51365758 ATGGCCTTCCCATCTAGTGATGG + Intergenic
1157872287 18:51241656-51241678 TTGAGCTTCCTATAGAGTGGTGG + Intergenic
1158190121 18:54818215-54818237 ATGCCCTTCCTAAAGAGTTAGGG + Intronic
1160774335 19:848189-848211 CTGTCCTTCCCATATAGGGAGGG + Intergenic
1160774357 19:848269-848291 CTGTCCTTCCCATATAGGGAGGG + Intergenic
1165899185 19:39160881-39160903 AGGTCCTTTCTTTAGAGTGGAGG + Intronic
926120296 2:10238036-10238058 GTGTCCTTCCTATAGAGGAAGGG - Intergenic
928872388 2:35995440-35995462 ATGGCTTTCCTTTATAGTGACGG - Intergenic
929686472 2:44039528-44039550 ATGTCTTTTCTATACAGTAAGGG - Intergenic
932812839 2:74838502-74838524 GTGTCCTGCCTATGGAGAGATGG + Intronic
932830002 2:74980194-74980216 AGGTCATTCCTAGAGAATGAGGG - Intergenic
936595646 2:113844893-113844915 ATGTCCTGCCTGGAGGGTGAAGG - Intergenic
940965657 2:159834372-159834394 ATTTCCTTCCTATAGAAAGCTGG - Intronic
941491742 2:166151084-166151106 ATGCACTTCCTATACAGGGAGGG - Intergenic
943045764 2:182860527-182860549 ATGTGATACCTATTGAGTGAGGG + Intronic
944149144 2:196538755-196538777 CTGTCCTTCATATAAAATGAAGG - Intronic
945236388 2:207635646-207635668 ATGTAATTCCTATAGCATGAAGG + Intergenic
1170582859 20:17711968-17711990 CCGTCCTTCCTAAAGAGTGATGG + Intronic
1170903927 20:20494334-20494356 ATGTCATTCCTCTTGAGGGATGG + Intronic
1173458207 20:43220773-43220795 ATTTCCGTCCTATAGATGGAGGG - Intergenic
1177030414 21:15976329-15976351 ATGTCTTTCCTTTAAACTGAAGG - Intergenic
1177108283 21:16989228-16989250 ATTTCCTTTCTATATATTGATGG + Intergenic
1177830191 21:26129887-26129909 TTTTCCTTCCTATAGAGGGAAGG + Intronic
1182579063 22:31293010-31293032 ATGGATTTCCTATAGAGTGAGGG - Intergenic
1182579137 22:31293674-31293696 ATGGATTTCCTATAGGGTGAGGG - Intergenic
1182951657 22:34381802-34381824 ATGTCCTTCCATTGGAGGGAGGG - Intergenic
1185399360 22:50607952-50607974 ATCTCCTTCCTCTAGGGTGCTGG - Intronic
950604780 3:14068932-14068954 ATGTCCTTCCTATAGAGTGAAGG + Intronic
951250336 3:20386953-20386975 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
952042348 3:29276477-29276499 ATGTCCTTCTTAAAGATAGAAGG + Intergenic
952245069 3:31579098-31579120 ATGTTCCTCTTTTAGAGTGAGGG + Intronic
952585499 3:34887354-34887376 ATGTACTACATATACAGTGATGG - Intergenic
953514950 3:43581170-43581192 CTGTCCTTCCACTACAGTGAAGG + Intronic
956198924 3:66684772-66684794 ATGTCCTTCCCTTAGAGTTTTGG + Intergenic
957136991 3:76301136-76301158 ATGTCCTTCCTTTAGATTTCTGG - Intronic
966536207 3:181037152-181037174 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
967733528 3:192928942-192928964 ATGCCCTTCCTTTAGAGGGCAGG - Intergenic
969762272 4:9196970-9196992 ATATCCTTCAAATAAAGTGACGG - Intergenic
969794106 4:9512573-9512595 ATGTTTTTCCTAAAGAGAGAAGG + Intergenic
970042545 4:11811979-11812001 ATGTCCTTGATATAGATTGATGG - Intergenic
970493958 4:16607001-16607023 ATTTCCTTTCTGTAGAGAGAAGG + Intronic
976198454 4:82556818-82556840 GTGTCCATCCCATAGGGTGATGG - Intronic
978065370 4:104392636-104392658 ATGTTCTTACAATAGAGTGGTGG + Intergenic
978806012 4:112801154-112801176 ATTTCCTTCCTATAGAGGTGGGG + Intergenic
981225728 4:142291694-142291716 ATGCCTTCCCTATAGAGAGATGG - Intronic
984276437 4:177616874-177616896 AAGACCTTCGTAGAGAGTGAGGG + Intergenic
989336791 5:40327096-40327118 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
990290870 5:54350119-54350141 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
993248789 5:85487644-85487666 ATGCCCTTCCAGAAGAGTGAAGG - Intergenic
996001994 5:118375720-118375742 ATGGCCGTCCTATAGAAGGATGG - Intergenic
996667442 5:126076331-126076353 ATACTCTTCCTATAGAGAGATGG + Intergenic
996814665 5:127561716-127561738 AGGTCCTTCTTATGGAGTGAAGG + Intergenic
1004821187 6:19369555-19369577 TTGTCTTTCCTTTAAAGTGAAGG - Intergenic
1007805962 6:44446874-44446896 ATGTCCGTCCTGTGGAGTTAAGG - Exonic
1008446794 6:51600976-51600998 ATGTCCTTGTTTTAGAGAGAAGG - Intergenic
1010535201 6:77018266-77018288 ATGTTGCTCCTATAAAGTGAGGG + Intergenic
1011096538 6:83672191-83672213 ATGAGCTCTCTATAGAGTGAAGG - Intronic
1011167798 6:84469240-84469262 AGGTCCAACCTAGAGAGTGATGG - Intergenic
1012381476 6:98624571-98624593 ATGTCCTTCTTTTTGAGTGTGGG - Intergenic
1018651539 6:165995783-165995805 ATTTGCTTCCTATAGAGTCTGGG - Intergenic
1023174267 7:37420479-37420501 ATGTTCTTCCTAGACAGTGATGG - Intronic
1023486170 7:40689573-40689595 ATGCCCTTCATATAGTGTGAAGG - Intronic
1026239915 7:68564325-68564347 ATGTTCTTCATATAAAGTGTTGG + Intergenic
1027906513 7:84191308-84191330 AAGTCCTTCCTATGAAGTTAAGG + Intronic
1029810797 7:103046421-103046443 ATGTCCTTCTAGAAGAGTGAAGG + Intronic
1031045613 7:116884032-116884054 ATCCCCTTCCTATTGAGAGAAGG - Intronic
1031305387 7:120119664-120119686 ATGTCCTTCTAAAAGAATGAAGG - Intergenic
1032385888 7:131523282-131523304 ATGTCCTTTCTATGTAGTGTTGG - Intronic
1036844253 8:12152094-12152116 ATATCCTTCAAATAAAGTGACGG + Intergenic
1036865625 8:12394416-12394438 ATATCCTTCAAATAAAGTGACGG + Intergenic
1039294734 8:36138157-36138179 ATGTCCCTCATTTAGGGTGAAGG + Intergenic
1041597092 8:59667607-59667629 ATGTCCTTCCTCTAGATTTCTGG + Intergenic
1043827090 8:84942282-84942304 ATGTCCTTCTAAAGGAGTGAAGG - Intergenic
1044024375 8:87150305-87150327 ATGACCGTACAATAGAGTGAAGG + Intronic
1045050771 8:98322589-98322611 ATCTCCTACTTATAAAGTGAGGG - Intergenic
1045383092 8:101646240-101646262 ATGGCTTTTCTATAGAGTCAGGG + Intronic
1049031106 8:140038408-140038430 ATTTCCACCCTCTAGAGTGAGGG - Intronic
1050658085 9:7851524-7851546 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1055970596 9:81908193-81908215 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1057578777 9:96266870-96266892 ACCTCCTGCCTGTAGAGTGAAGG - Intronic
1058047265 9:100369934-100369956 ATGTCCATCCAAAAGAGTGAAGG - Intergenic
1058125764 9:101193030-101193052 ATGCTCTTCCAATTGAGTGAGGG + Intronic
1059017996 9:110543098-110543120 ATATCCTTCCTATGGCATGAAGG - Intronic
1062156394 9:135051206-135051228 ATGTTCTTCCTACAATGTGAGGG + Intergenic
1192260323 X:69502514-69502536 GTGTCCCTCCCATAGAGGGAGGG - Intergenic
1196970764 X:121105941-121105963 ATTTCCTTCCAACAGACTGAAGG - Intergenic
1197131673 X:123012758-123012780 ATGTATTCCCTAAAGAGTGATGG + Intergenic
1197515756 X:127426289-127426311 ATGTGACTGCTATAGAGTGAGGG + Intergenic
1197618845 X:128723788-128723810 ATGTCCTTTCTATAAAGAAAGGG + Intergenic
1199863471 X:151822323-151822345 ATGTTATTCCTATAGTGTCATGG - Intergenic