ID: 950606197

View in Genome Browser
Species Human (GRCh38)
Location 3:14083051-14083073
Sequence TCCAAACCGTTAACATCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 48
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 43}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950606197 Original CRISPR TCCAAACCGTTAACATCAGG AGG (reversed) Intergenic
903174459 1:21572603-21572625 TCCAAAGCGCTAACAGCATGTGG + Intronic
924285237 1:242479110-242479132 TCCTAACTGTTTACAACAGGAGG - Intronic
1066695447 10:38073306-38073328 TCTAAACCATAAACATGAGGGGG - Intergenic
1077992471 11:7424280-7424302 TCCAAACCTTTGGCATCATGGGG - Intronic
1081223054 11:40486399-40486421 TTCACACAGTCAACATCAGGGGG + Intronic
1086814856 11:91357250-91357272 TCAAAACTGGTCACATCAGGAGG + Intergenic
1087626323 11:100601117-100601139 TCCAATCTGTTATCATCAGCTGG + Intergenic
1091010899 11:131999379-131999401 TCCTAACAGTTGACATCAGTCGG - Intronic
1098624657 12:72648919-72648941 TCCAATCCATGAACATCAGATGG - Intronic
1100377011 12:94026715-94026737 TCCATATGGTTAACATCAGTTGG + Intergenic
1103421194 12:120784829-120784851 TCCAGATGGTTAACACCAGGAGG - Intronic
1110565846 13:76956957-76956979 TACAAACCGTAACCACCAGGAGG - Intronic
1112969648 13:105244836-105244858 TCAAAGCTGTCAACATCAGGTGG + Intergenic
1117593131 14:57297129-57297151 TCCAAACCCCAAACATCTGGAGG - Exonic
1137419614 16:48320611-48320633 TCCAAACTTCTAAAATCAGGCGG + Intronic
1142376391 16:89709038-89709060 TCCCAGCCGTGCACATCAGGAGG - Intronic
1148337988 17:46854142-46854164 ACCAAACACTTAACATCATGAGG - Intronic
1149120199 17:53153608-53153630 TCCACATCCTTAACATCAGTTGG + Intergenic
1150482117 17:65518595-65518617 ACCAAGATGTTAACATCAGGAGG + Intergenic
1151461831 17:74258915-74258937 TCCAGGCCATTCACATCAGGGGG - Intronic
1155290217 18:24333049-24333071 TCCGAACAGTTAACATCAGGAGG + Exonic
926258904 2:11238308-11238330 TCCAATCCGTGTACATGAGGTGG - Intronic
927002118 2:18807759-18807781 TACAAACTGTCAATATCAGGAGG + Intergenic
928427178 2:31189001-31189023 TCCAGACCTTGAACTTCAGGAGG + Intronic
928436853 2:31260363-31260385 TCCAAACAGTTAAAATGTGGAGG + Intronic
933381430 2:81551770-81551792 TCCAAACTATTAACATCATTGGG + Intergenic
936607999 2:113976740-113976762 CACAAACCGTTTACATCATGGGG + Intergenic
1184218680 22:43084827-43084849 TCCAATCTCTTATCATCAGGTGG + Intronic
950606197 3:14083051-14083073 TCCAAACCGTTAACATCAGGAGG - Intergenic
971766942 4:30844826-30844848 TCCACAGGGTTAAAATCAGGTGG + Intronic
973626786 4:52780631-52780653 TCCAAAATGTTAACAGTAGGAGG + Intergenic
980995899 4:139779341-139779363 CCCAAAGTGTTATCATCAGGTGG + Intronic
993277679 5:85882073-85882095 TACAAACAATTATCATCAGGTGG - Intergenic
995235370 5:109823329-109823351 CCCAAACCCTGAACATTAGGGGG + Intronic
995940509 5:117576774-117576796 TCCAAACATTTAATTTCAGGTGG + Intergenic
999627143 5:153532732-153532754 CCCAAACCGGAAACACCAGGAGG - Intronic
999847240 5:155497688-155497710 TTCAAACCATTAACATCAGAAGG - Intergenic
1000022979 5:157334939-157334961 TCCCCACTGTTAACATCTGGCGG - Intronic
1016083518 6:139883872-139883894 TCCAAAGTGTTGACATCAGCAGG - Intergenic
1018666884 6:166147026-166147048 TTCTAACCTTTAACATCAGGTGG + Intergenic
1019791597 7:3017543-3017565 TCTTAACCGTTAACATCTAGAGG - Intronic
1031440348 7:121787112-121787134 TCCAAACATTTAATCTCAGGAGG + Intergenic
1040551346 8:48439814-48439836 TCCAAACAGTTATCATTCGGGGG + Intergenic
1040757194 8:50791069-50791091 TCCAAACCTTTCACATTAGGTGG + Intronic
1044872525 8:96633282-96633304 TCCAAACCCTAAAAATCTGGTGG + Intergenic
1186285369 X:8038091-8038113 TCCAAGCTGTGAACACCAGGAGG + Intergenic
1198337422 X:135680218-135680240 TTCAAACTGTCAACATAAGGTGG - Intergenic
1199776409 X:151015691-151015713 TCCAAACCTTTAACATTCAGAGG + Intergenic