ID: 950607586

View in Genome Browser
Species Human (GRCh38)
Location 3:14096453-14096475
Sequence TACATTATGACGGACCAGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950607581_950607586 8 Left 950607581 3:14096422-14096444 CCCTGCGACTTCCAGGGCAGCAA No data
Right 950607586 3:14096453-14096475 TACATTATGACGGACCAGTGTGG No data
950607580_950607586 13 Left 950607580 3:14096417-14096439 CCAATCCCTGCGACTTCCAGGGC No data
Right 950607586 3:14096453-14096475 TACATTATGACGGACCAGTGTGG No data
950607582_950607586 7 Left 950607582 3:14096423-14096445 CCTGCGACTTCCAGGGCAGCAAA No data
Right 950607586 3:14096453-14096475 TACATTATGACGGACCAGTGTGG No data
950607584_950607586 -3 Left 950607584 3:14096433-14096455 CCAGGGCAGCAAAGGAGAAGTAC No data
Right 950607586 3:14096453-14096475 TACATTATGACGGACCAGTGTGG No data
950607578_950607586 14 Left 950607578 3:14096416-14096438 CCCAATCCCTGCGACTTCCAGGG No data
Right 950607586 3:14096453-14096475 TACATTATGACGGACCAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950607586 Original CRISPR TACATTATGACGGACCAGTG TGG Intergenic
No off target data available for this crispr