ID: 950609387

View in Genome Browser
Species Human (GRCh38)
Location 3:14116156-14116178
Sequence CAGCAGTTATAGGTAGGTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 79}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950609387_950609395 21 Left 950609387 3:14116156-14116178 CCTTAACCTACCTATAACTGCTG 0: 1
1: 0
2: 0
3: 4
4: 79
Right 950609395 3:14116200-14116222 CAAAACTTAGCTGTTGTGCCAGG 0: 1
1: 0
2: 0
3: 27
4: 250
950609387_950609396 22 Left 950609387 3:14116156-14116178 CCTTAACCTACCTATAACTGCTG 0: 1
1: 0
2: 0
3: 4
4: 79
Right 950609396 3:14116201-14116223 AAAACTTAGCTGTTGTGCCAGGG 0: 1
1: 0
2: 0
3: 11
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950609387 Original CRISPR CAGCAGTTATAGGTAGGTTA AGG (reversed) Intronic
909713912 1:78684053-78684075 CAGAAGGTAAAGGTAGCTTATGG - Intergenic
911924240 1:103807884-103807906 CAGCAGATATAGGTGGGTATTGG + Intergenic
912526755 1:110289217-110289239 CAGAAGTCAGAGGTAGGTTAGGG + Intergenic
915017603 1:152749733-152749755 GAGAAGTTAGATGTAGGTTAAGG + Intronic
916855094 1:168741181-168741203 CTGCAGTTAGAGGGAGGCTATGG + Intergenic
1063947596 10:11192548-11192570 CAGCTGTTATGGGGAGGTGAAGG - Intronic
1065153339 10:22844999-22845021 CAGCATTTATAAGGAGGTGAGGG + Intergenic
1068051038 10:51949597-51949619 CAGGAATTAAAGGTATGTTAAGG + Intronic
1070087704 10:73252707-73252729 CAGCAGTTTAAGGTACGTTAGGG - Intergenic
1070992983 10:80748996-80749018 CATCAGCTGTAGGTAGGGTATGG + Intergenic
1076243858 10:128931266-128931288 CAGTGGTGAAAGGTAGGTTATGG - Intergenic
1076976990 11:180478-180500 CACCATTTATGGGAAGGTTATGG - Intronic
1079441880 11:20523234-20523256 AAGTAGTAATAGGAAGGTTAGGG + Intergenic
1081809853 11:45908645-45908667 CAGCAGACATAGGGAGATTAAGG - Intergenic
1082252977 11:50002239-50002261 TAGCAGTTAGAGGCAGGTTTAGG - Intergenic
1082724584 11:56719676-56719698 AAGCAGTTATAGTTATGTGAAGG - Intergenic
1084161270 11:67351721-67351743 CAGCAGGTATTGGAAGGTGATGG + Exonic
1086926648 11:92648144-92648166 CAGTAGTGGTAGGTAGGGTAGGG + Intronic
1088311736 11:108467460-108467482 CAGCAGCGATTGGTAGGTGAAGG - Exonic
1089299398 11:117489558-117489580 CAGCAGCTTTAGGTGGGGTAGGG + Intronic
1091760746 12:3085606-3085628 CAGCAGTTACAGGTAGGAGCAGG - Intronic
1093294594 12:17372845-17372867 CAGCAGTTATAATTACATTATGG - Intergenic
1096395056 12:51259672-51259694 CAGGAGTTACAGATAGGTTGTGG + Intronic
1097952577 12:65448621-65448643 CAGCAGTTACAAGTAGCTAATGG - Intronic
1100302849 12:93324072-93324094 AAGCAGTCACAGGGAGGTTATGG - Intergenic
1107563230 13:41576458-41576480 CAGCAGTTTCAGTTATGTTATGG - Intronic
1108032531 13:46250162-46250184 CAGCATTAATAGGTATGATATGG - Intronic
1110751158 13:79118314-79118336 GGGAAGTTCTAGGTAGGTTAGGG - Intergenic
1120855969 14:89212731-89212753 CAGAAGTGATAAGTAGTTTAAGG - Intronic
1122087536 14:99318020-99318042 CAGCAGTTTGAAGAAGGTTATGG + Intergenic
1122223603 14:100258964-100258986 AAGCAGTTATATGTAGTTTTTGG + Intronic
1124164310 15:27310167-27310189 CAGCAGTTATGGGTAGGGAAGGG + Intronic
1127016412 15:54693685-54693707 CAGCAGTAATAAATAGCTTATGG + Intergenic
1127056440 15:55136712-55136734 CACCAATTAAAGGTAGGTTTTGG - Intergenic
1131863854 15:96685542-96685564 AATCAATTCTAGGTAGGTTAAGG + Intergenic
1137777179 16:51065819-51065841 CAGTAGGTATACGTAGGGTATGG - Intergenic
1140913858 16:79477582-79477604 AAGCAGCTATAGGAATGTTAAGG - Intergenic
1143690834 17:8563802-8563824 CAGCAGTTAAAGCTAGGTAAGGG - Intronic
1144282752 17:13743020-13743042 AAGCAGTTGAAGGTAGGTGAGGG - Intergenic
1150853342 17:68726709-68726731 CAGCAGTAATAAGAAGGTTTGGG + Intergenic
1153719479 18:7887307-7887329 CAACACTCATGGGTAGGTTAGGG + Intronic
1159834571 18:73323124-73323146 CATCAGTTGAAGGTATGTTAAGG + Intergenic
1164147389 19:22520305-22520327 AAACAGTTATAGGCAGGTTTGGG - Intronic
1166692165 19:44828979-44829001 AAGCAGTTATAGGCAGGGCATGG - Intergenic
930901248 2:56509908-56509930 CAGCAGTTAAATCTAGGTGATGG - Intergenic
936706062 2:115075045-115075067 AAGCAGTTATACGTGGGTCATGG + Intronic
944944708 2:204670309-204670331 AAGCAGTGATAGGTAGGATTTGG + Intronic
947103444 2:226645820-226645842 CAGCAGCAATAGGTTGGTTGTGG - Intergenic
1173255638 20:41392696-41392718 CAGGAGTTCAAGGTTGGTTACGG + Intergenic
1177395667 21:20532904-20532926 CAGGAGTGATAGGAAGGTTTAGG - Intergenic
950609387 3:14116156-14116178 CAGCAGTTATAGGTAGGTTAAGG - Intronic
951458699 3:22924380-22924402 CACCACTTAAAGGTAGATTATGG + Intergenic
956932919 3:74066020-74066042 CAGCAGTTAGAGGTAGGAAGAGG + Intergenic
964880320 3:161416583-161416605 GAGCAATTTTAGGTAGGATAAGG + Intergenic
968673482 4:1864530-1864552 CAGCCTTTATAGGGAGGTCAGGG + Intergenic
977434303 4:96973451-96973473 CAGCAGAAATGGGTAGTTTATGG + Intergenic
981394409 4:144230095-144230117 AAGCAGTTATAGGTAGAGAATGG + Intergenic
981666064 4:147228036-147228058 CTTCAGGTATAGGTAGGTTCAGG - Intergenic
982546231 4:156736528-156736550 CAGGTGATATAGGAAGGTTAAGG + Intergenic
987279014 5:16393595-16393617 CAGCAGTTGTAAATAGCTTAAGG - Intergenic
990578276 5:57144939-57144961 CAGCATTTTTCGGTAGGTTGAGG - Intergenic
993581806 5:89672098-89672120 CAGCCTTTATAGGTAGAATATGG - Intergenic
995454969 5:112341301-112341323 TATCAGTTTTAGGAAGGTTAAGG - Intronic
997923133 5:138001947-138001969 CAGCAGTTAGAGGTGGGATGGGG + Intronic
998093166 5:139382613-139382635 CAGCAGAGATAAGTAGCTTAGGG + Intronic
1001444404 5:171772191-171772213 AAGCAGTCATAGGCTGGTTAGGG - Intergenic
1010300940 6:74258334-74258356 CAGTAGTTATATGTTGGTGAAGG + Intergenic
1012855951 6:104501920-104501942 AAGCAGGTATAGTTTGGTTATGG - Intergenic
1012885987 6:104846462-104846484 CACCAATTATAGGGAGCTTATGG + Intronic
1015231557 6:130920929-130920951 CAGCAGTTTGAGGTATGCTAGGG - Intronic
1022005707 7:26263640-26263662 AAGGAGTTATAGCCAGGTTAGGG - Intergenic
1027576577 7:79937920-79937942 CAGCAGTGAGAGGTAGATGATGG - Intergenic
1029033002 7:97488446-97488468 CAGCAGTTGCAGGGAGGATAGGG + Intergenic
1030554979 7:111012666-111012688 CTGGAGTTTTAGGTAAGTTAGGG + Intronic
1040550609 8:48434514-48434536 CAGGAGTTAAAGGGAGGTGAAGG - Intergenic
1049969353 9:807828-807850 CAGAAGTTTGAGGAAGGTTAAGG - Intergenic
1050170619 9:2812114-2812136 CAGCAGTTTTAGAGAGGGTATGG + Intronic
1051990576 9:23147211-23147233 CAACAGTTATGGGCAGGTAAGGG - Intergenic
1053435858 9:38073877-38073899 GAGCAGTTAAAGGAATGTTAAGG + Intergenic
1057330506 9:94110180-94110202 CAACAGAAATAGGAAGGTTAAGG + Intergenic
1186590271 X:10923172-10923194 CTGCAGATATATGTGGGTTATGG - Intergenic
1187055806 X:15740621-15740643 CAGCAGTTACAGGTATATCAAGG - Intronic
1187899365 X:24012822-24012844 TAGGACTTAAAGGTAGGTTAGGG - Intronic
1190841569 X:54149729-54149751 CAGGGGTTAAAGGTAGGTTTGGG + Intronic