ID: 950610956

View in Genome Browser
Species Human (GRCh38)
Location 3:14126133-14126155
Sequence ATGCACACCCTGGCCTCTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 607
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 579}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950610956_950610960 7 Left 950610956 3:14126133-14126155 CCTTGAGAGGCCAGGGTGTGCAT 0: 1
1: 0
2: 1
3: 26
4: 579
Right 950610960 3:14126163-14126185 AGCCCTAGTACACTTTGTCTCGG 0: 1
1: 0
2: 0
3: 8
4: 74
950610956_950610961 8 Left 950610956 3:14126133-14126155 CCTTGAGAGGCCAGGGTGTGCAT 0: 1
1: 0
2: 1
3: 26
4: 579
Right 950610961 3:14126164-14126186 GCCCTAGTACACTTTGTCTCGGG 0: 1
1: 0
2: 1
3: 6
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950610956 Original CRISPR ATGCACACCCTGGCCTCTCA AGG (reversed) Intronic
900037863 1:432687-432709 ACACACACCAGGGCCTCTCAGGG + Intergenic
900037883 1:432764-432786 ACACACACCAGGGCCTCTCAGGG + Intergenic
900037904 1:432841-432863 ACACACACCAGGGCCTCTCAGGG + Intergenic
900037925 1:432918-432940 ACACACACCAGGGCCTCTCAGGG + Intergenic
900037946 1:432995-433017 ACACACACCAGGGCCTCTCAGGG + Intergenic
900037967 1:433072-433094 ACACACACCAGGGCCTCTCAGGG + Intergenic
900037987 1:433149-433171 ACACACACCAGGGCCTCTCAGGG + Intergenic
900038008 1:433226-433248 ACACACACCAGGGCCTCTCAGGG + Intergenic
900038028 1:433303-433325 ACACACACCAGGGCCTCTCAGGG + Intergenic
900038048 1:433380-433402 ACACACACCAGGGCCTCTCAGGG + Intergenic
900038068 1:433457-433479 ACACACACCAGGGCCTCTCAGGG + Intergenic
900038088 1:433534-433556 ACACACACCAGGGCCTCTCAGGG + Intergenic
900038108 1:433611-433633 ACACACACCAGGGCCTCTCAGGG + Intergenic
900038128 1:433688-433710 ACACACACCAGGGCCTCTCAGGG + Intergenic
900038148 1:433765-433787 ACACACACCAGGGCCTCTCAGGG + Intergenic
900038168 1:433842-433864 ACACACACCAGGGCCTCTCAGGG + Intergenic
900038188 1:433919-433941 ACACACACCAGGGCCTCTCAGGG + Intergenic
900038208 1:433996-434018 ACACACACCAGGGCCTCTCAGGG + Intergenic
900038228 1:434073-434095 ACACACACCAGGGCCTCTCAGGG + Intergenic
900038248 1:434150-434172 ACACACACCAGGGCCTCTCAGGG + Intergenic
900038268 1:434227-434249 ACACACACCAGGGCCTCTCAGGG + Intergenic
900038304 1:434381-434403 ACACACACCAGGGCCTCTCAGGG + Intergenic
900038324 1:434458-434480 ACACACACCAGGGCCTCTCAGGG + Intergenic
900038344 1:434535-434557 ACACACACCAGGGCCTCTCAGGG + Intergenic
900038364 1:434612-434634 ACACACACCAGGGCCTCTCAGGG + Intergenic
900038384 1:434689-434711 ACACACACCAGGGCCTCTCAGGG + Intergenic
900038404 1:434766-434788 ACACACACCAGGGCCTCTCAGGG + Intergenic
900038425 1:434843-434865 ACACACACCAGGGCCTCTCAGGG + Intergenic
900038446 1:434920-434942 ACACACACCAGGGCCTCTCAGGG + Intergenic
900059480 1:668363-668385 ACACACACCAGGGCCTCTCAGGG + Intergenic
900059499 1:668439-668461 ACACACACCAGGGCCTCTCAGGG + Intergenic
900059518 1:668515-668537 ACACACACCAGGGCCTCTCAGGG + Intergenic
900059537 1:668591-668613 ACACACACCAGGGCCTCTCAGGG + Intergenic
900059575 1:668745-668767 ACACACACCAGGGCCTCTCAGGG + Intergenic
900059596 1:668822-668844 ACACACACCAGGGCCTCTCAGGG + Intergenic
900059633 1:668975-668997 ACACACACCAGGGCCTCTCAGGG + Intergenic
900059654 1:669052-669074 ACACACACCAGGGCCTCTCAGGG + Intergenic
900059676 1:669129-669151 ACACACACCAGGGCCTCTCAGGG + Intergenic
900059696 1:669206-669228 ACACACACCAGGGCCTCTCAGGG + Intergenic
900059718 1:669283-669305 ACACACACCAGGGCCTCTCAGGG + Intergenic
900059778 1:669514-669536 ACACACACCAGGGCCTCTCAGGG + Intergenic
900059799 1:669591-669613 ACACACACCAGGGCCTCTCAGGG + Intergenic
900059819 1:669668-669690 ACACACACCAGGGCCTCTCAGGG + Intergenic
900059839 1:669745-669767 ACACACACCAGGGCCTCTCAGGG + Intergenic
900059861 1:669822-669844 ACACACACCAGGGCCTCTCAGGG + Intergenic
900059882 1:669899-669921 ACACACACCAGGGCCTCTCAGGG + Intergenic
900551807 1:3260162-3260184 ACCCACACCCTGGCCTAGCAGGG + Intronic
900681902 1:3920984-3921006 ATGCAAGCCCTGGCCTCTGACGG + Intergenic
900791483 1:4683817-4683839 AGTCCCACCCTGGCCTCTCTGGG - Intronic
901022388 1:6261754-6261776 CTGCAGACCCTGGCCTCTCCCGG - Intergenic
901532978 1:9864983-9865005 CTGCCCACCTTGGCCTCCCAAGG - Intronic
901939745 1:12652874-12652896 GTCCACACCCTGGCTTTTCAGGG + Intronic
902710334 1:18234955-18234977 ATTCACACTCTGGCCTCTAGAGG - Intronic
903503066 1:23812596-23812618 CTGCCCACCTTGGCCTCCCAAGG + Intronic
904391811 1:30190973-30190995 ATTCAAACCCAGGCCTGTCAGGG - Intergenic
904499887 1:30907884-30907906 ATGCACACCCTCCCCTCGGAAGG + Intronic
904521776 1:31101339-31101361 TTGCACACCCTGACCTCTCCTGG - Intergenic
904610411 1:31722947-31722969 ATGCCCACCCTGGCACCTCATGG - Intergenic
905904153 1:41605672-41605694 ATACACACACTGGGCTCTGAAGG + Intronic
908758814 1:67493194-67493216 ATGGACACATTGGCCTCTGAAGG - Intergenic
910703493 1:90102375-90102397 ATGCAAACCTTGGCCTATCCTGG - Intergenic
910957677 1:92724562-92724584 CTGCCCACCTTGGCCTCCCAGGG - Intronic
910995188 1:93097051-93097073 CTGCCCACCTTGGCCTCCCAAGG + Intronic
911067147 1:93800328-93800350 CTGCCCACCTTGGCCTCCCAAGG - Intronic
912211922 1:107565872-107565894 CTTCACACCCTGTCCTCTAATGG - Intergenic
912674910 1:111670226-111670248 CTGCCCACCTTGGCCTCCCAAGG - Intronic
914827177 1:151144882-151144904 AGGCACAGCCTGCTCTCTCAGGG - Intronic
915334005 1:155130118-155130140 CTGCAAAGCCTGGCCTCTCAGGG + Intronic
917321824 1:173790524-173790546 CTGCCCACCTTGGCCTCCCAAGG - Intergenic
917945164 1:179962088-179962110 CTGCCCACCTTGGCCTCCCAAGG + Intronic
918343597 1:183587106-183587128 AGGCCCACCCTGTGCTCTCACGG + Intronic
920173321 1:204084769-204084791 ATTCACCCCCTTGCCTCTCAGGG + Intronic
920297680 1:204969033-204969055 ATGCCCACCCTTCCCTCTGAGGG + Intronic
920650324 1:207832716-207832738 ATATTCACCCTGGCCTCTGAAGG - Intergenic
920797572 1:209155310-209155332 ATTCCCAGCCTGCCCTCTCAAGG + Intergenic
921551892 1:216546966-216546988 ATACACACCGGGGCCTGTCAGGG - Intronic
921606259 1:217159199-217159221 CTGCCCACCTTGGCCTCCCAAGG + Intergenic
922474734 1:225899165-225899187 AGTCACATCCTGGCCTATCAGGG + Intronic
922477468 1:225916519-225916541 GGGCACACCCAGGCCTCACAGGG + Intronic
923160488 1:231310549-231310571 ATGCCCTCCCTGAGCTCTCAGGG + Intergenic
923187981 1:231592475-231592497 CTGCCCACCTTGGCCTCCCAAGG - Intronic
923323267 1:232857502-232857524 AGGTAGACCCTGACCTCTCAGGG - Intergenic
923574551 1:235146187-235146209 CTGCCCACCTTGGCCTCTAATGG + Intronic
924408821 1:243782063-243782085 CTGCCCACCTTAGCCTCTCAAGG + Intronic
924626545 1:245700446-245700468 CTGCCCACCTTGGCCTCCCAAGG - Intronic
1062830217 10:600421-600443 CTGCACACCCTGGGCTGTCGTGG - Intronic
1062847268 10:717711-717733 CTGCACACCCTTGGCTCTCAGGG - Intergenic
1062950148 10:1492868-1492890 AAGCTCTCCCAGGCCTCTCATGG - Intronic
1064729868 10:18319427-18319449 ACCCACACCAGGGCCTCTCAGGG + Intronic
1065781988 10:29177778-29177800 ATGCACACTCTTACCTCCCAGGG + Intergenic
1065907473 10:30271037-30271059 CTGCCCACCTTGGCCTCCCAAGG - Intergenic
1069275768 10:66588596-66588618 ATGCATACCCTAGCCTATAAAGG - Intronic
1070119779 10:73564817-73564839 CTTCCCACCTTGGCCTCTCAAGG - Intronic
1071560894 10:86646127-86646149 CTGCCCACCTTGGCCTCCCAAGG + Intergenic
1072047652 10:91672786-91672808 CTGCATACGCTGTCCTCTCATGG + Intergenic
1072411076 10:95202581-95202603 ATGCACATCTTGCCCTCTCTGGG + Intronic
1072463344 10:95640583-95640605 CTGCCCACCTTGGCCTCCCAAGG + Intronic
1072543148 10:96413635-96413657 ATTCACACCGTGGTCTCTCCGGG - Intronic
1072707745 10:97693962-97693984 CTGCCCACCTTGGCCTCCCAAGG - Intergenic
1072781575 10:98255390-98255412 ATCCATACCCTGCCCCCTCACGG - Intronic
1073004861 10:100315437-100315459 ACACACACCCAGGCCTGTCACGG - Intronic
1075391764 10:122097434-122097456 AGGCGCACCCTGCCCTCTCTCGG - Intronic
1075411406 10:122231259-122231281 ATGCAAACCTTGGTCTCTGAGGG + Intronic
1075692213 10:124404798-124404820 CTGCCCACCTTGGCCTCCCAAGG - Intronic
1076056380 10:127377025-127377047 AAACACACCCTGGGTTCTCAAGG + Intronic
1076892815 10:133293038-133293060 ATGGACATCCTGGCCTCCCTCGG - Exonic
1076964593 11:70597-70619 ACACACACCAGGGCCTCTCAGGG + Intergenic
1076964612 11:70674-70696 ACACACACCAGGGCCTCTCAGGG + Intergenic
1076964632 11:70751-70773 ACACACACCAGGGCCTCTCAGGG + Intergenic
1076964651 11:70828-70850 ACACACACCAGGGCCTCTCAGGG + Intergenic
1077369185 11:2173642-2173664 GTGCAGACCCTGTCCTCTCTCGG + Intergenic
1077455356 11:2675065-2675087 ATGCCCACACTAGCCTCTCCAGG - Intronic
1077740776 11:4843049-4843071 ATGCAAGGCGTGGCCTCTCAAGG + Intronic
1077799152 11:5521257-5521279 CTGCCCACCTTGGCCTCCCAAGG - Intronic
1078628249 11:12978188-12978210 CTGCGCACCTTGGCCTCCCAAGG + Intergenic
1079311581 11:19371317-19371339 ATGCAGACTCTGGCCTCCAATGG - Intronic
1080342667 11:31284880-31284902 CTGCCCACCTTGGCCTCCCAAGG + Intronic
1080531872 11:33184348-33184370 CTGCCCACCTTGGCCTCCCAAGG + Intergenic
1082013795 11:47469350-47469372 ATCCAGGCCCTGGCCACTCAAGG + Intronic
1083182586 11:60996709-60996731 AGGCACACCCTGCCCTGTCCTGG + Intronic
1083311952 11:61788299-61788321 ATGCACACGCAGGCTTCTAAGGG - Exonic
1083557058 11:63638459-63638481 CTGCCCACCTTGGCCTCCCAAGG - Intronic
1083883240 11:65558479-65558501 CTGCACACCCTCGCTTCTCCAGG - Intronic
1084012479 11:66360324-66360346 CCGCCCACCTTGGCCTCTCAAGG + Intronic
1084275551 11:68049423-68049445 ATGCACACCATCACCTCTGACGG - Intronic
1084426674 11:69087834-69087856 ATGCACACAGGGGCCTCTAAAGG - Intronic
1085165391 11:74395648-74395670 CTGCCCACCTTGGCCTCCCAGGG + Intronic
1085294339 11:75422506-75422528 ATGCACACTCTGCTCCCTCATGG - Exonic
1088711288 11:112511236-112511258 CTGAATTCCCTGGCCTCTCAGGG - Intergenic
1090718869 11:129454467-129454489 AGGCCCAGCCTGGCCTCTCTGGG - Intergenic
1090825207 11:130380405-130380427 TTGCCCACCTTGGCCTCCCAAGG + Intergenic
1091246359 11:134098954-134098976 CTGCCCACCTTGGCCTCCCAAGG - Intronic
1091830585 12:3547532-3547554 CTGCCCACCTTGGCCTCCCAAGG - Intronic
1092490997 12:8944915-8944937 CTGCCCACCTTGGCCTCCCAAGG - Intronic
1094180401 12:27586452-27586474 CTGCCCACCTTGGCCTCCCAAGG - Intronic
1094484852 12:30916562-30916584 AAGCCCTCCCTGGCCTCTCTAGG - Intergenic
1096286797 12:50307439-50307461 CTGCCCACCTTGGCCTCCCAAGG + Intergenic
1097067704 12:56333195-56333217 ATGGACATCCTGGCCTGTAAGGG + Exonic
1097163973 12:57072192-57072214 CTGCCCACCTTGGCCTCCCAAGG - Intronic
1100101601 12:91113744-91113766 ATACACACCCGGGCCTGTCAGGG + Intergenic
1102731359 12:115113752-115113774 ACACACACCCGGGCCTGTCATGG + Intergenic
1103369591 12:120408761-120408783 ATCCAAACCCTGGCCCCTCCTGG + Intergenic
1104694015 12:130849664-130849686 CTGCCCACCTTGGCCTCCCAAGG + Intergenic
1104925578 12:132312522-132312544 ATGCCCACGCTGTCCTCTGATGG + Intronic
1106683342 13:32031175-32031197 GAGCACACCCGGGCCGCTCACGG + Intergenic
1107051955 13:36060112-36060134 CTGCCCACCTTGGCCTCCCAAGG + Intronic
1107411000 13:40158755-40158777 ATGCACACCTCAGCCTATCAGGG + Intergenic
1107992565 13:45831306-45831328 GTGCATACACTGGCCTCTCCTGG - Intronic
1108291400 13:48965319-48965341 CCGCACACCTTGGCCTCCCAAGG - Intergenic
1108562446 13:51659168-51659190 CTGCCCACCTTGGCCTCCCAAGG + Intronic
1108694692 13:52892657-52892679 ATGCACATCCTCTCCTCCCAAGG - Intergenic
1111583018 13:90249513-90249535 CTGCCCACCTCGGCCTCTCAAGG - Intergenic
1112643516 13:101304439-101304461 ATACACACCAGGGCCTGTCAGGG - Intronic
1112762446 13:102706468-102706490 ATACACACCAGGGCCTGTCAGGG - Intergenic
1113788508 13:113015417-113015439 ATGCCCACCCTGGGCCATCAGGG + Intronic
1113961067 13:114126355-114126377 ATGCACGGCCTGGCCTTTGAGGG - Intronic
1114513494 14:23281718-23281740 CTGCCCACCTTGGCCTCCCAAGG - Intronic
1115037951 14:28883608-28883630 CTGCTCGCCCTGGCCTCCCAGGG + Intergenic
1115583400 14:34785097-34785119 CTGCCCACCTTGGCCTCCCAAGG + Intronic
1115633022 14:35264363-35264385 CTGCCCACCTTGGCCTCCCAAGG + Intronic
1117068446 14:52033871-52033893 ACGCACACCCTTACCCCTCATGG - Intronic
1118639515 14:67779317-67779339 CTGCCCACCTTGGCCTCCCAAGG - Intronic
1118884769 14:69857350-69857372 CTGCCCACCTTGGCCTCCCAAGG + Intronic
1119395441 14:74322888-74322910 CTGCCCACCTTGGCCTCTCAAGG - Intronic
1120227660 14:81809220-81809242 ATGCACAGTGTGGCCACTCAGGG + Intergenic
1121211023 14:92207950-92207972 AGGCAAACCTCGGCCTCTCAAGG + Intergenic
1122080076 14:99261023-99261045 GTGAACACCCTGTCATCTCAGGG - Intronic
1122367057 14:101200567-101200589 CTGCACCCCCTTGCTTCTCAGGG - Intergenic
1122860117 14:104578775-104578797 TGGCACACCCTGGGCTCCCAGGG + Intronic
1123006371 14:105325710-105325732 ATCCACATCCTGGCCTGCCAGGG - Intronic
1124431718 15:29614129-29614151 AAGCTCTCCATGGCCTCTCAGGG + Intergenic
1126313349 15:47341144-47341166 CTGCCCACCTTGGCCTCCCAAGG - Intronic
1127532918 15:59862759-59862781 ATGAACACTCTGCCCTCTCTAGG + Intergenic
1129243119 15:74263385-74263407 AGGCAAAGCCTGTCCTCTCAGGG - Intronic
1130970567 15:88728774-88728796 CTGCCCACCTTGGCCTCCCAAGG - Intergenic
1131007206 15:88987712-88987734 ATGGACATCCTGGGCTCCCATGG + Intergenic
1131220795 15:90582357-90582379 ATGCAGACCCAAGCCTCTAAAGG - Intronic
1131320270 15:91382733-91382755 ATACACACCATGGCCTGTAAGGG + Intergenic
1132338463 15:101063557-101063579 ATGCACAGACAGGCCCCTCAGGG - Intronic
1132418904 15:101647435-101647457 TTGCACAGCCTGGCAACTCAGGG + Intronic
1132443470 15:101892697-101892719 ACACACACCAGGGCCTCTCAGGG - Intergenic
1132443491 15:101892774-101892796 ACACACACCAGGGCCTCTCAGGG - Intergenic
1132443511 15:101892851-101892873 ACACACACCAGGGCCTCTCAGGG - Intergenic
1132443533 15:101892928-101892950 ACACACACCAGGGCCTCTCAGGG - Intergenic
1132443572 15:101893081-101893103 ACACACACCAGGGCCTCTCAGGG - Intergenic
1132443593 15:101893158-101893180 ACACACACCAGGGCCTCTCAGGG - Intergenic
1132443613 15:101893235-101893257 ACACACACCAGGGCCTCTCAGGG - Intergenic
1132443633 15:101893312-101893334 ACACACACCAGGGCCTCTCAGGG - Intergenic
1132443674 15:101893466-101893488 ACACACACCAGGGCCTCTCAGGG - Intergenic
1132443695 15:101893543-101893565 ACACACACCAGGGCCTCTCAGGG - Intergenic
1132443716 15:101893620-101893642 ACACACACCAGGGCCTCTCAGGG - Intergenic
1132443737 15:101893697-101893719 ACACACACCAGGGCCTCTCAGGG - Intergenic
1132443759 15:101893774-101893796 ACACACACCAGGGCCTCTCAGGG - Intergenic
1132443777 15:101893851-101893873 ACACACACCAGGGCCTCTCAGGG - Intergenic
1132443797 15:101893928-101893950 ACACACACCAGGGCCTCTCAGGG - Intergenic
1132443818 15:101894005-101894027 ACACACACCAGGGCCTCTCAGGG - Intergenic
1132443838 15:101894082-101894104 ACACACACCAGGGCCTCTCAGGG - Intergenic
1132443857 15:101894159-101894181 ACACACACCAGGGCCTCTCAGGG - Intergenic
1132443878 15:101894236-101894258 ACACACACCAGGGCCTCTCAGGG - Intergenic
1132443899 15:101894312-101894334 ACACACACCAGGGCCTCTCAGGG - Intergenic
1132443918 15:101894389-101894411 ACACACACCAGGGCCTCTCAGGG - Intergenic
1132443939 15:101894466-101894488 ACACACACCAGGGCCTCTCAGGG - Intergenic
1133998900 16:10767290-10767312 ATGCACACCCAGGTTTCTCTAGG - Exonic
1136225108 16:28855115-28855137 CTGCCCACCTTGGCCTCTGAAGG + Intronic
1136508072 16:30719137-30719159 CTGCCCACCTTGGCCTCCCAAGG + Intronic
1139710949 16:68775617-68775639 ATGCACACACTAGCCACACATGG + Intronic
1139802491 16:69534798-69534820 CTGCCCACCTTGGCCTCCCAAGG + Intergenic
1139907621 16:70377579-70377601 CTGCCCACCTTGGCCTCCCAAGG - Exonic
1139958778 16:70705884-70705906 ACCCACACTCTTGCCTCTCATGG - Intronic
1140226195 16:73079279-73079301 CTGCCCACCTTGGCCTCCCAAGG - Intergenic
1141499276 16:84432436-84432458 ATCCACACCCAGGCCTGTCGGGG - Intronic
1142019429 16:87771816-87771838 CTGCCCACCTTGGCCTCCCAAGG - Intergenic
1142203846 16:88773470-88773492 CTGCACAGCCTGGCCTCACTAGG + Intronic
1142486126 17:248572-248594 ATGCCCACCCTGAACTCACAGGG + Intronic
1144387514 17:14763197-14763219 ATGGAAAGCATGGCCTCTCAGGG + Intergenic
1145929249 17:28672905-28672927 CTGCCCACCTTGGCCTCCCAAGG - Intronic
1146224632 17:31054836-31054858 ATGCAAAGCCTGGCCTGGCACGG - Intergenic
1146795898 17:35780589-35780611 GTGCCCACCTCGGCCTCTCAAGG - Intronic
1147677529 17:42218474-42218496 ATCCTCTCCCTGGACTCTCACGG - Intronic
1148244160 17:46019610-46019632 ATGCCCACCTCGGCCTCCCAAGG + Intronic
1149652660 17:58286115-58286137 ATGTACAACAAGGCCTCTCAAGG - Intergenic
1151764982 17:76128633-76128655 CTGCCCACCTTGGCCTCCCAAGG - Intergenic
1151797881 17:76358585-76358607 CTGCCCACCCTGGCCTCTCAAGG - Intronic
1151842982 17:76630830-76630852 CTGCCCACCTTGGCCTCCCAAGG + Intronic
1152977622 18:238107-238129 TTGCCCACCTTGGCCTCCCAAGG + Intronic
1153981637 18:10315418-10315440 CTGCACTCCCTGCCCTCTCTGGG - Intergenic
1155036066 18:22026083-22026105 CTGCCCACACTGGCCTCCCAAGG + Intergenic
1155132032 18:22945625-22945647 CTGCCCACCTTGGCCTCCCAAGG + Intronic
1155809982 18:30220222-30220244 TTGCACACCATGGCCTGTCAGGG + Intergenic
1156340902 18:36209945-36209967 CTGCCCACCTTGGCCTCCCAAGG + Intronic
1157980161 18:52370543-52370565 ATACACACTCAGGCCTGTCAGGG + Intronic
1158072645 18:53491521-53491543 ATGTACACCAAGGCCTCTCGGGG - Intronic
1158543815 18:58379099-58379121 ACGCACACCCCGCCCTCCCAGGG - Intronic
1158679245 18:59551986-59552008 ACGCACGCCTTGGCCACTCATGG + Intronic
1159452612 18:68621564-68621586 ATGCACACTGGGGCCTGTCAGGG + Intergenic
1160272711 18:77402449-77402471 ATGCACACCCTATGCTCTAATGG - Intergenic
1160641396 19:140229-140251 ACACACACCAGGGCCTCTCAGGG + Intergenic
1160641436 19:140383-140405 ACACACACCAGGGCCTCTCAGGG + Intergenic
1160641457 19:140460-140482 ACACACACCAGGGCCTCTCAGGG + Intergenic
1161787277 19:6334588-6334610 CTGCCCACCTTGGCCTCCCAAGG + Intergenic
1163621140 19:18361073-18361095 ATGCCCACCTTGGCCTCCCAAGG + Intronic
1164174668 19:22760499-22760521 CTGCCCACCTAGGCCTCTCAAGG - Intronic
1164448583 19:28338777-28338799 CTGCCCACCTTGGCCTCCCAAGG + Intergenic
1165995232 19:39839349-39839371 ATGCAGTCGCTGCCCTCTCATGG + Intronic
1167489784 19:49785671-49785693 CTGCCCACCTTGGCCTCCCAAGG - Intronic
1167585420 19:50372239-50372261 CTGCCCACCTTGGCCTCCCAAGG - Intronic
1168047934 19:53807440-53807462 GTCCCCACCGTGGCCTCTCATGG - Intronic
925946032 2:8864727-8864749 CTGCACACCCAGGTCTCACAGGG + Intronic
926016618 2:9458585-9458607 CTGCCCACCTTGGCCTCCCAAGG - Intronic
927252660 2:21011831-21011853 ATGCAGAGCTTGGCCTCTCTGGG - Exonic
927440122 2:23109144-23109166 ATGCACACTAAGGCCTGTCAAGG - Intergenic
927762395 2:25770992-25771014 CTGCCCACCTTGGCCTCCCAAGG - Intronic
928004045 2:27547416-27547438 CTGCTCACCTTGGCCTCCCAAGG + Intronic
928368906 2:30724627-30724649 CTGGACACCCTGGCATCTCAAGG + Intronic
928705730 2:33947557-33947579 CTGCCCACCTTGGCCTCCCACGG - Intergenic
930720788 2:54635630-54635652 ACACACATCCTCGCCTCTCACGG - Intronic
931361661 2:61583256-61583278 CTGCCCACCTTGGCCTCCCAAGG + Intergenic
931658229 2:64529908-64529930 ATGCCCGCCTTGGCCTCCCAAGG - Intronic
931972871 2:67609314-67609336 ATGCAGACCCTTCCCTCACAAGG - Intergenic
932193740 2:69764525-69764547 AGGCTCACAGTGGCCTCTCAGGG - Intronic
932869721 2:75386419-75386441 ACACACACCGTGGCCTGTCAGGG - Intergenic
933557821 2:83852086-83852108 ACACACACCGTGGCCTGTCAGGG + Intergenic
935150998 2:100435716-100435738 CTGCCCACCTTGGCCTCCCAAGG - Intergenic
935359365 2:102234548-102234570 CTGCCCACCTCGGCCTCTCAAGG - Intronic
936928562 2:117763037-117763059 ACACACACCAGGGCCTCTCAGGG + Intergenic
937265954 2:120614784-120614806 CTGCCCTCCCTGTCCTCTCAGGG - Intergenic
938200925 2:129372723-129372745 AGGCCTACCCTGGACTCTCATGG + Intergenic
938900756 2:135796901-135796923 ATGCACACCCTGGCCTAGTTAGG - Intronic
939011012 2:136845944-136845966 ATCCACACCATGGCCAGTCACGG - Intronic
939348799 2:141004508-141004530 ATGTACACCATGGACTCTCATGG + Intronic
939492872 2:142898121-142898143 CTGCCCACCTTGGCCTCCCAAGG + Intronic
940403475 2:153273109-153273131 ATACACACCGGGGCCTGTCAGGG + Intergenic
941063236 2:160871744-160871766 CTGTCCACCTTGGCCTCTCAAGG + Intergenic
943410311 2:187538565-187538587 TCACACACCCTGGCCTGTCAGGG + Intronic
944389573 2:199203571-199203593 ATGCTCTCCCTTGCCTCTCCTGG + Intergenic
948820576 2:240541964-240541986 CTGCCCACCTTGGCCTCTCAAGG - Intronic
948951091 2:241252256-241252278 CTGCCCACCTTGGCCTCCCAAGG - Intronic
1170066467 20:12316082-12316104 ATGCCCACCTTCTCCTCTCAGGG + Intergenic
1170887219 20:20351335-20351357 CTGCCCGCCTTGGCCTCTCAAGG - Intronic
1170898036 20:20434229-20434251 CCACACACACTGGCCTCTCATGG + Intronic
1171359128 20:24574232-24574254 CTGCCCACCTTGGCCTCCCAAGG - Intronic
1171485890 20:25485489-25485511 ATGCACATCCTGACCCTTCACGG - Intronic
1172145532 20:32755252-32755274 ATGCACACCCTGGCCAGGCGTGG + Intergenic
1172911791 20:38414985-38415007 CTGCCCACCTTGGCCTCCCAAGG - Intergenic
1173118257 20:40266847-40266869 TTGCACACCTGGGCTTCTCACGG - Intergenic
1173321641 20:41992545-41992567 ATGGACACTGTGTCCTCTCATGG + Intergenic
1173485923 20:43441018-43441040 CTGCCCACCTTGGCCTCCCAAGG - Intergenic
1174293574 20:49527198-49527220 CTGCCCACCTTGGCCTCCCAAGG - Intronic
1174392461 20:50226453-50226475 ATGCGGCCCCTTGCCTCTCAGGG + Intergenic
1174428697 20:50451780-50451802 CTGCCCACCTTGGCCTCCCAAGG - Intergenic
1174690445 20:52499056-52499078 ATGCACAGGTTGTCCTCTCAAGG - Intergenic
1175146535 20:56900792-56900814 CTGCCCACCTTGGCCTCCCAAGG + Intergenic
1175348796 20:58302920-58302942 CTGCCCACCTTGGCCTCCCAAGG + Intergenic
1175785617 20:61710037-61710059 AGGCCCACCCTGGCCGCCCACGG - Intronic
1176764276 21:13000336-13000358 CTGCCCACCTTGGCCTCCCAAGG + Intergenic
1177398961 21:20577077-20577099 CTGCCCACCTTGGCCTCCCAAGG - Intergenic
1177731373 21:25031032-25031054 ACGGACACCCTGGCATCTCTAGG + Intergenic
1179541353 21:42085171-42085193 ATGCAGAGCAGGGCCTCTCATGG + Intronic
1181289571 22:21781300-21781322 CTGCCCACCTTGGCCTCCCAAGG - Intronic
1181292297 22:21805432-21805454 AGGCCCACCTTGGCCTCCCAAGG + Intronic
1181296088 22:21840502-21840524 CTGCCCACCTTGGCCTCCCAGGG - Intronic
1181392017 22:22590277-22590299 TTGCACACCTAGGCCTCCCAAGG + Intergenic
1183550302 22:38478884-38478906 CTGCCCACCTTGGCCTCCCAAGG + Intronic
1184078343 22:42198906-42198928 CTGCCCACCTTGGCCTCCCAAGG + Intronic
1184300402 22:43555459-43555481 GTTCATTCCCTGGCCTCTCAGGG - Intronic
1184795332 22:46728844-46728866 CAGCACACCCTGGCTTCTCTGGG - Intronic
1185384204 22:50524316-50524338 ATGCAGGGCCTGGCCTCCCAGGG + Exonic
949545414 3:5068178-5068200 CTGCCCTCCTTGGCCTCTCAAGG - Intergenic
950610956 3:14126133-14126155 ATGCACACCCTGGCCTCTCAAGG - Intronic
952522132 3:34172007-34172029 ACACACACCGTGGCCTGTCATGG - Intergenic
953244358 3:41177248-41177270 TTGCAATCCCTGGCCTCTCTGGG + Intergenic
953399087 3:42597157-42597179 ATAGACACACTGGACTCTCAGGG + Intronic
954266794 3:49475956-49475978 CTGCCCACCTTGGCCTCCCAAGG + Intronic
955290108 3:57684216-57684238 CTGCCCACCTTGGCCTCCCAAGG - Intronic
955325418 3:58006433-58006455 CTGCCCACCTTGGCCTCCCAAGG + Intergenic
956383618 3:68692812-68692834 CTGCCCACCTTGGCCTCCCAAGG - Intergenic
957375237 3:79347966-79347988 CTGCCCACCTTGGCCTCTTAAGG - Intronic
961695855 3:128704036-128704058 AGGAACACCGTGGCCTCACATGG - Intergenic
962158888 3:132978231-132978253 ATGGACACTCTTGCCTCTAAAGG - Intergenic
963444666 3:145388800-145388822 CTGCCCACCTTGGCCTCCCAAGG - Intergenic
963976014 3:151481165-151481187 ATGCAGACCCTTGCATCCCAGGG + Intergenic
964885493 3:161477476-161477498 CTGCCCACCTTGGCCTCCCAAGG + Intergenic
965331063 3:167375346-167375368 CTGCCCACCTTGGCCTCCCAAGG - Intronic
966718820 3:183040465-183040487 CTGCCCACCTTGGCCTTTCAAGG - Intronic
967738881 3:192983527-192983549 ACACCCACCATGGCCTCTCAAGG + Intergenic
968152148 3:196345406-196345428 CTGCCCACCTTGGCCTCCCAAGG + Intergenic
968185620 3:196632133-196632155 ATGCACACCCTGCCTGGTCACGG - Intergenic
968275973 3:197440597-197440619 CTGCCCACCTTGGCCTCCCACGG - Intergenic
969277671 4:6147829-6147851 ATGGCCACCCTGGCCTCACAGGG + Intronic
969468486 4:7371797-7371819 CTGCACGCCCAGGCCTCTGACGG + Intronic
969640317 4:8394414-8394436 GTCCACACCCCTGCCTCTCAAGG - Intronic
970375380 4:15451763-15451785 ATGCACTCCCCTGCCTCTCAAGG + Intergenic
970687100 4:18580899-18580921 ATGCACTCCGGGGCCTGTCAAGG - Intergenic
971340407 4:25763602-25763624 CTGCCCACCTTGGCCTCCCAAGG - Intronic
972228225 4:37039869-37039891 CGGCCCACCATGGCCTCTCAAGG - Intergenic
975266069 4:72369465-72369487 CTGCCCACCTCGGCCTCTCAAGG - Intronic
975780963 4:77839482-77839504 CTGCCCACCTTGGCCTCCCAAGG - Intergenic
976217215 4:82726750-82726772 CTGCACACTGTGGCCTCACAGGG - Intronic
977466919 4:97393931-97393953 CTGCCCACCTTGGCCTCCCAAGG + Intronic
980976020 4:139611270-139611292 CTGCCCACCTTGGCCTCCCAAGG + Intergenic
982227334 4:153178043-153178065 CTGCACACCTCGGCCTCCCAAGG + Intronic
982232510 4:153222327-153222349 ATGCAAACACTGTCCTTTCAGGG - Intronic
985146510 4:186899534-186899556 CTGCCCACCTTGGCCTCCCAAGG - Intergenic
985615167 5:915771-915793 AAGCACACCCTGGGTTCACAGGG - Intronic
985732375 5:1556518-1556540 ATGGCCACCCTGGCCTCCCCAGG + Intergenic
988679592 5:33471965-33471987 TTGCCCACCGTGGCCTCCCAAGG - Intergenic
990200834 5:53371406-53371428 ATGCACACTGAGGCCTCTCAGGG + Intergenic
990613952 5:57488125-57488147 ATTCACACCTTGGCATGTCATGG - Intergenic
994037810 5:95222946-95222968 ATCCACACCATCGTCTCTCATGG - Intronic
994340167 5:98617665-98617687 AGGGTCTCCCTGGCCTCTCATGG - Intergenic
994541559 5:101105494-101105516 CTGCCCACCTTGGCCTCCCAAGG + Intergenic
997480783 5:134183118-134183140 CTGCCCACCTTGGCCTCCCAAGG - Intronic
998113678 5:139520770-139520792 CTGCCCACCTTGGCCTCCCAAGG - Intergenic
999597443 5:153220844-153220866 ATACACACCAGGGCCTGTCAGGG + Intergenic
999721688 5:154403253-154403275 ATTCAAACCCAGGCCTCCCAAGG + Intronic
1001090113 5:168733608-168733630 ACACACACCATGGCCTGTCAAGG + Intronic
1001758057 5:174185944-174185966 GTCCACACCCTGGCCTCCTAGGG + Intronic
1002405327 5:179025671-179025693 CTGCCCACCTTGGCCTCCCAAGG - Intronic
1002735401 5:181384023-181384045 ACACACACCAGGGCCTCTCAGGG - Intergenic
1002735423 5:181384100-181384122 ACACACACCCGGGCCTCTCAGGG - Intergenic
1002735444 5:181384177-181384199 ACACACACCAGGGCCTCTCAGGG - Intergenic
1002735465 5:181384254-181384276 ACACACACCAGGGCCTCTCAGGG - Intergenic
1002735485 5:181384331-181384353 ACACACACCAGGGCCTCTCAGGG - Intergenic
1002735505 5:181384408-181384430 ACACACACCAGGGCCTCTCAGGG - Intergenic
1002735563 5:181384639-181384661 ACACACACCAGGGCCTCTCAGGG - Intergenic
1002735583 5:181384716-181384738 ACACACACCAGGGCCTCTCAGGG - Intergenic
1002735603 5:181384793-181384815 ACACACACCAGGGCCTCTCAGGG - Intergenic
1002735623 5:181384870-181384892 ACACACACCAGGGCCTCTCAGGG - Intergenic
1002735644 5:181384947-181384969 ACACACACCAGGGCCTCTCAGGG - Intergenic
1002735664 5:181385024-181385046 ACACACACCAGGGCCTCTCAGGG - Intergenic
1002735701 5:181385178-181385200 ACACACACCAGGGCCTCTCAGGG - Intergenic
1002735720 5:181385255-181385277 ACACACACCAGGGCCTCTCAGGG - Intergenic
1002735739 5:181385332-181385354 ACACACACCAGGGCCTCTCAGGG - Intergenic
1002735759 5:181385409-181385431 ACACACACCAGGGCCTCTCAGGG - Intergenic
1002735780 5:181385486-181385508 ACACACACCAGGGCCTCTCAGGG - Intergenic
1002735801 5:181385563-181385585 ACACACACCAGGGCCTCTCAGGG - Intergenic
1002735820 5:181385640-181385662 ACACACACCAGGGCCTCTCAGGG - Intergenic
1002735842 5:181385717-181385739 ACACACACCAGGGCCTCTCAGGG - Intergenic
1002735917 5:181386025-181386047 ACACACACCAGGGCCTCTCAGGG - Intergenic
1002735938 5:181386102-181386124 ACACACACCAGGGCCTCTCAGGG - Intergenic
1002735958 5:181386179-181386201 ACACACACCAGGGCCTCTCAGGG - Intergenic
1002748724 6:88569-88591 ACACACACCAGGGCCTCTCAGGG + Intergenic
1002748744 6:88646-88668 ACACACACCAGGGCCTCTCAGGG + Intergenic
1002748763 6:88721-88743 ACACACACCAGGGCCTCTCAGGG + Intergenic
1002748782 6:88797-88819 ACACACACCAGGGCCTCTCAGGG + Intergenic
1002748802 6:88874-88896 ACACACACCAGGGCCTCTCAGGG + Intergenic
1002748822 6:88951-88973 ACACACACCAGGGCCTCTCAGGG + Intergenic
1002748841 6:89027-89049 ACACACACCAGGGCCTCTCAGGG + Intergenic
1002748861 6:89104-89126 ACACACACCAGGGCCTCTCAGGG + Intergenic
1002748880 6:89181-89203 ACACACACCAGGGCCTCTCAGGG + Intergenic
1002748902 6:89258-89280 ACACACACCAGGGCCTCTCAGGG + Intergenic
1002748920 6:89334-89356 ACACACACCAGGGCCTCTCAGGG + Intergenic
1002748942 6:89411-89433 ACACACACCAGGGCCTCTCAGGG + Intergenic
1002748962 6:89488-89510 ACACACACCAGGGCCTCTCAGGG + Intergenic
1002749021 6:89719-89741 ACACACACCAGGGCCTCTCAGGG + Intergenic
1002749042 6:89796-89818 ACACACACCAGGGCCTCTCAGGG + Intergenic
1002749061 6:89872-89894 ACACACACCAGGGCCTCTCAGGG + Intergenic
1002749098 6:90025-90047 ACACACACCAGGGCCTCTCAGGG + Intergenic
1002749119 6:90102-90124 ACACACACCAGGGCCTCTCAGGG + Intergenic
1002825687 6:771716-771738 ATGCACACTGGGGCCTGTCATGG - Intergenic
1004256762 6:14071537-14071559 CTGCCCACCTTGGCCTCCCAAGG - Intergenic
1004424521 6:15498345-15498367 ATGCAGACCCTTGCTCCTCAGGG + Intronic
1005067834 6:21835664-21835686 CTGCCCACCTTGACCTCTCAAGG + Intergenic
1006464211 6:34181696-34181718 CTGTCCACCCTGGCCTCCCAAGG - Intergenic
1006896182 6:37472593-37472615 ATGCCCACCATGGGCTCTAAGGG + Intronic
1007653811 6:43439823-43439845 CTGCCCACCTTGGCCTCCCAAGG + Intronic
1010914557 6:81599772-81599794 CTGCACATCATGGCCACTCAAGG - Intronic
1010939938 6:81904851-81904873 CTGCCCACCTTGGCCTCTCAAGG - Intergenic
1014155311 6:118102794-118102816 ATTGAGACCCTTGCCTCTCAAGG - Intronic
1014206553 6:118662284-118662306 CTGCCCACCTTGGCCTCCCAAGG - Intronic
1015981482 6:138843931-138843953 CCGCCCACCCTGGCCTCCCAAGG + Intronic
1016044254 6:139465204-139465226 CTGCCCACCTTGGCCTCCCAAGG - Intergenic
1016102596 6:140120717-140120739 TCACACACCATGGCCTCTCAGGG + Intergenic
1017806046 6:157946372-157946394 AGGCACCCTCTGGCCACTCAAGG + Intergenic
1019239667 6:170656340-170656362 ACACACACCAGGGCCTCTCAGGG - Intergenic
1019239706 6:170656494-170656516 ACACACACCAGGGCCTCTCAGGG - Intergenic
1019239743 6:170656648-170656670 ACACACACCAGGGCCTCTCAGGG - Intergenic
1019239763 6:170656725-170656747 ACACACACCAGGGCCTCTCAGGG - Intergenic
1019239805 6:170656879-170656901 ACACACACCAGGGCCTCTCAGGG - Intergenic
1019239846 6:170657033-170657055 ACACACACCAGGGCCTCTCAGGG - Intergenic
1019239886 6:170657186-170657208 ACACACACCAGGGCCTCTCAGGG - Intergenic
1019239906 6:170657263-170657285 ACACACACCAGGGCCTCTCAGGG - Intergenic
1019239926 6:170657339-170657361 ACACACACCAGGGCCTCTCAGGG - Intergenic
1019239945 6:170657416-170657438 ACACACACCAGGGCCTCTCAGGG - Intergenic
1019239984 6:170657570-170657592 ACACACACCAGGGCCTCTCAGGG - Intergenic
1019240005 6:170657647-170657669 ACACACACCAGGGCCTCTCAGGG - Intergenic
1019240062 6:170657861-170657883 ACACACACCAGGGCCTCTCAGGG - Intergenic
1019240082 6:170657938-170657960 ACACACACCAGGGCCTCTCAGGG - Intergenic
1019240103 6:170658015-170658037 ACACACACCAGGGCCTCTCAGGG - Intergenic
1019240124 6:170658092-170658114 ACACACACCAGGGCCTCTCAGGG - Intergenic
1019240144 6:170658169-170658191 ACACACACCAGGGCCTCTCAGGG - Intergenic
1019240183 6:170658323-170658345 ACACACACCAGGGCCTCTCAGGG - Intergenic
1019240204 6:170658400-170658422 ACACACACCAGGGCCTCTCAGGG - Intergenic
1019240225 6:170658477-170658499 ACACACACCAGGGCCTCTCAGGG - Intergenic
1019240262 6:170658631-170658653 ACACACACCAGGGCCTCTCAGGG - Intergenic
1019240300 6:170658785-170658807 ACACACACCAGGGCCTCTCAGGG - Intergenic
1019240320 6:170658862-170658884 ACACACACCAGGGCCTCTCAGGG - Intergenic
1019240340 6:170658939-170658961 ACACACACCAGGGCCTCTCAGGG - Intergenic
1019240359 6:170659016-170659038 ACACACACCAGGGCCTCTCAGGG - Intergenic
1019240398 6:170659170-170659192 ACACACACCAGGGCCTCTCAGGG - Intergenic
1019240418 6:170659247-170659269 ACACACACCAGGGCCTCTCAGGG - Intergenic
1019240438 6:170659324-170659346 ACACACACCAGGGCCTCTCAGGG - Intergenic
1019240458 6:170659401-170659423 ACACACACCAGGGCCTCTCAGGG - Intergenic
1019240478 6:170659478-170659500 ACACACACCAGGGCCTCTCAGGG - Intergenic
1019240554 6:170659786-170659808 ACACACACCAGGGCCTCTCAGGG - Intergenic
1019240574 6:170659862-170659884 ACACACACCAGGGCCTCTCAGGG - Intergenic
1019240593 6:170659939-170659961 ACACACACCAGGGCCTCTCAGGG - Intergenic
1019240631 6:170660093-170660115 ACACACACCAGGGCCTCTCAGGG - Intergenic
1019240670 6:170660247-170660269 ACACACACCAGGGCCTCTCAGGG - Intergenic
1019240726 6:170660478-170660500 ACACACACCAGGGCCTCTCAGGG - Intergenic
1019240746 6:170660554-170660576 ACACACACCAGGGCCTCTCAGGG - Intergenic
1019240766 6:170660631-170660653 ACACACACCAGGGCCTCTCAGGG - Intergenic
1019240786 6:170660708-170660730 ACACACACCAGGGCCTCTCAGGG - Intergenic
1019240806 6:170660785-170660807 ACACACACCAGGGCCTCTCAGGG - Intergenic
1019240826 6:170660861-170660883 ACACACACCAGGGCCTCTCAGGG - Intergenic
1019240865 6:170661014-170661036 ACACACACCAGGGCCTCTCAGGG - Intergenic
1019240886 6:170661091-170661113 ACACACACCAGGGCCTCTCAGGG - Intergenic
1019240907 6:170661168-170661190 ACACACACCAGGGCCTCTCAGGG - Intergenic
1019240967 6:170661398-170661420 ACACACACCAGGGCCTCTCAGGG - Intergenic
1019240987 6:170661475-170661497 ACACACACCAGGGCCTCTCAGGG - Intergenic
1019241028 6:170661629-170661651 ACACACACCAGGGCCTCTCAGGG - Intergenic
1019340706 7:507545-507567 CTTCCCACCCTGGCCTGTCATGG - Intronic
1020170958 7:5844673-5844695 CTGCCCACCTTGGCCTCCCAAGG + Intergenic
1020205328 7:6110075-6110097 CTGCCCACCTTGGCCTCCCAAGG + Intronic
1021635140 7:22684435-22684457 TTGCCCACCTTGGCCTCCCAAGG + Intergenic
1021888644 7:25165589-25165611 CTGCCCACCTTGGCCTCCCAAGG + Intronic
1023823685 7:43994725-43994747 CTGCTCACCTTGGCCTCCCAAGG + Intergenic
1024767685 7:52680052-52680074 CTGCCCACCTTGGCCTCCCAAGG - Intergenic
1025138497 7:56441700-56441722 CTGCACACCTCGGCCTCCCAAGG - Intergenic
1025228042 7:57180494-57180516 CTGCCCACCTTGGCCTCCCAAGG - Intergenic
1025245967 7:57317682-57317704 CTGCCCACCTTGGCCTCCCAAGG + Intergenic
1028561152 7:92178068-92178090 CTGCACGCCTGGGCCTCTCAAGG - Intronic
1029247631 7:99214184-99214206 CTGCCCACCTTGGCCTCCCAAGG - Intergenic
1029509783 7:100986807-100986829 CCACACACCCTGTCCTCTCAAGG + Intronic
1029684165 7:102134089-102134111 CTGCCCACCTTGGCCTCTCAAGG - Intronic
1029934329 7:104407411-104407433 CTGCCCACCTTGGCCTCCCAAGG - Intronic
1030084198 7:105803217-105803239 CTGCCCTCCCTGGCCTCCCATGG - Intronic
1030129481 7:106185775-106185797 CTGCCCACCTTGGCCTCCCAAGG + Intergenic
1032436378 7:131904346-131904368 ATGCATAACATGGCTTCTCATGG - Intergenic
1032779569 7:135153210-135153232 CTGCCCACCTTGGCCTCTGAAGG - Intronic
1033933935 7:146559324-146559346 CTGCCCACCTCGGCCTCTCAAGG - Intronic
1034139413 7:148802209-148802231 ATGCACACCCGACCCTCTCCTGG + Intergenic
1034560801 7:151877980-151878002 ATGCCCACCCGGGGCTCTAAAGG - Intergenic
1034966765 7:155396271-155396293 CTGCCCACCTTGGCCTCCCAAGG - Exonic
1035250424 7:157593600-157593622 ACGCTCACCCCGGCTTCTCAGGG - Intronic
1035507045 8:146312-146334 ACACACACCAGGGCCTCTCAGGG + Intergenic
1035507065 8:146389-146411 ACACACACCAGGGCCTCTCAGGG + Intergenic
1035507086 8:146466-146488 ACACACACCAGGGCCTCTCAGGG + Intergenic
1035507106 8:146543-146565 ACACACACCAGGGCCTCTCAGGG + Intergenic
1035507127 8:146620-146642 ACACACACCAGGGCCTCTCAGGG + Intergenic
1035507186 8:146851-146873 ACACACACCAGGGCCTCTCAGGG + Intergenic
1035507244 8:147082-147104 ACACACACCAGGGCCTCTCAGGG + Intergenic
1035507263 8:147159-147181 ACACACACCAGGGCCTCTCAGGG + Intergenic
1035507284 8:147236-147258 ACACACACCAGGGCCTCTCAGGG + Intergenic
1035507341 8:147467-147489 ACACACACCAGGGCCTCTCAGGG + Intergenic
1035507361 8:147544-147566 ACACACACCAGGGCCTCTCAGGG + Intergenic
1035507382 8:147621-147643 ACACACACCAGGGCCTCTCAGGG + Intergenic
1035507402 8:147697-147719 ACACACACCAGGGCCTCTCAGGG + Intergenic
1035507461 8:147928-147950 ACACACACCAGGGCCTCTCAGGG + Intergenic
1035507482 8:148005-148027 ACACACACCAGGGCCTCTCAGGG + Intergenic
1035507502 8:148081-148103 ACACACACCAGGGCCTCTCAGGG + Intergenic
1035507523 8:148158-148180 ACACACACCAGGGCCTCTCAGGG + Intergenic
1035507543 8:148235-148257 ACACACACCAGGGCCTCTCAGGG + Intergenic
1037593473 8:20333359-20333381 CTGCCCACCTTGGCCTCCCAAGG + Intergenic
1037994069 8:23340108-23340130 ACGCACACCCTGGCCTCTGGAGG - Intronic
1039013736 8:33123663-33123685 ATCCACACCCTGGTTTTTCAGGG + Intergenic
1039760990 8:40575086-40575108 ATGACCACCCTGGCTGCTCAAGG + Intronic
1040592371 8:48805459-48805481 CTGCACTCCCTGGCCGGTCAAGG - Intergenic
1041088072 8:54275159-54275181 CTGCCCACCTTGGCCTCCCAAGG + Intergenic
1043463205 8:80481232-80481254 ATGCCCGCCTTGGCCTCCCAAGG + Intergenic
1044739838 8:95314880-95314902 ATGGCCACTTTGGCCTCTCATGG + Intergenic
1045907894 8:107370445-107370467 CTGCACACCTTGGCCTCCCAAGG - Intronic
1046766505 8:118075207-118075229 GTGCACAGCCTGGTCTCTCTGGG - Intronic
1047507077 8:125488425-125488447 CTGCACAGCCTGGCCTCTGGAGG + Intergenic
1047924984 8:129674038-129674060 ATACACACCCTGGCCTGTGGGGG - Intergenic
1047952397 8:129945815-129945837 CTGCCCACCTTGGCCTCCCAAGG + Intronic
1047994569 8:130321544-130321566 ATGCACCCCCTGACTTCTAAGGG - Intronic
1048426746 8:134330172-134330194 ATACACACCAGGGCCTGTCAAGG - Intergenic
1048541098 8:135342793-135342815 ATGCACACCGGGGCCTGTCAGGG - Intergenic
1049730108 8:144172650-144172672 CTGCCCACCTTGGCCTCCCAAGG + Intronic
1051408862 9:16768254-16768276 TTGCATACACTGGCCTGTCATGG - Intronic
1052127316 9:24793069-24793091 TCACACACCCTGGCCTTTCAGGG + Intergenic
1052294919 9:26886970-26886992 CTGCCCACCTTGGCCTCCCAAGG - Intronic
1052312015 9:27077399-27077421 CTGCCCACCTTGGCCTCCCAAGG + Intergenic
1052888519 9:33673307-33673329 TTGCACACCGGGGCCTGTCATGG + Intergenic
1052911779 9:33889445-33889467 CTGCCCACCTTGGCCTCCCAAGG + Intronic
1053545591 9:39020015-39020037 CTGCCCACCTTGGCCTCTCAAGG + Intergenic
1054942599 9:70759813-70759835 TCGCACACCAGGGCCTCTCAGGG + Intronic
1054948275 9:70820546-70820568 ATGAACACCTTGGGCTCTGATGG + Intronic
1055045082 9:71915418-71915440 CTGCCCACCTTGGCCTCCCAAGG + Intronic
1055113602 9:72584508-72584530 CTGCCCACCTTGGCCTCCCAAGG + Intronic
1056147853 9:83752158-83752180 CTGCTCGCCTTGGCCTCTCAGGG - Intronic
1056263258 9:84870595-84870617 CTTCACACCTTGGCCTCCCAAGG + Intronic
1056656907 9:88516981-88517003 CCGCCCACCTTGGCCTCTCAAGG + Intergenic
1057053853 9:91946769-91946791 TTTCCCATCCTGGCCTCTCAGGG + Intronic
1058053769 9:100429944-100429966 CTGCCCACCTTGGCCTCCCAAGG + Intronic
1058944969 9:109847496-109847518 CTGCCCACCTTGGCCTCCCAAGG - Intronic
1059061872 9:111041524-111041546 CTGCCCACCTTGGCCTCCCAAGG - Intergenic
1060521026 9:124294120-124294142 CCTCCCACCCTGGCCTCTCAAGG - Intronic
1062030983 9:134361915-134361937 GTGCACACCCTGGCCCCCCAGGG - Intronic
1062267883 9:135695711-135695733 AGGCACAGCCCTGCCTCTCATGG + Intronic
1062328274 9:136023144-136023166 ACGCATATCCTGGCCTCTCTGGG + Intronic
1062329137 9:136029195-136029217 ATGCACATCCTGCCCTCTGAAGG + Intronic
1203600323 Un_KI270748v1:7403-7425 ACACACACCAGGGCCTCTCAGGG - Intergenic
1203600344 Un_KI270748v1:7480-7502 ACACACACCAGGGCCTCTCAGGG - Intergenic
1203600365 Un_KI270748v1:7557-7579 ACACACACCAGGGCCTCTCAGGG - Intergenic
1203600404 Un_KI270748v1:7711-7733 ACACACACCAGGGCCTCTCAGGG - Intergenic
1203600424 Un_KI270748v1:7788-7810 ACACACACCAGGGCCTCTCAGGG - Intergenic
1203600445 Un_KI270748v1:7865-7887 ACACACACCAGGGCCTCTCAGGG - Intergenic
1203600464 Un_KI270748v1:7942-7964 ACACACACCAGGGCCTCTCAGGG - Intergenic
1203600502 Un_KI270748v1:8096-8118 ACACACACCAGGGCCTCTCAGGG - Intergenic
1203600542 Un_KI270748v1:8250-8272 ACACACACCAGGGCCTCTCAGGG - Intergenic
1203600562 Un_KI270748v1:8327-8349 ACACACACCAGGGCCTCTCAGGG - Intergenic
1203600601 Un_KI270748v1:8481-8503 ACACACACCAGGGCCTCTCAGGG - Intergenic
1203600658 Un_KI270748v1:8712-8734 ACACACACCAGGGCCTCTCAGGG - Intergenic
1203600679 Un_KI270748v1:8789-8811 ACACACACCAGGGCCTCTCAGGG - Intergenic
1203600700 Un_KI270748v1:8866-8888 ACACACACCAGGGCCTCTCAGGG - Intergenic
1203600720 Un_KI270748v1:8943-8965 ACACACACCAGGGCCTCTCAGGG - Intergenic
1203600741 Un_KI270748v1:9020-9042 ACACACACCAGGGCCTCTCAGGG - Intergenic
1203600762 Un_KI270748v1:9097-9119 ACACACACCAGGGCCTCTCAGGG - Intergenic
1203600783 Un_KI270748v1:9174-9196 ACACACACCAGGGCCTCTCAGGG - Intergenic
1203600802 Un_KI270748v1:9251-9273 ACACACACCAGGGCCTCTCAGGG - Intergenic
1203600823 Un_KI270748v1:9328-9350 ACACACACCAGGGCCTCTCAGGG - Intergenic
1203600861 Un_KI270748v1:9482-9504 ACACACACCAGGGCCTCTCAGGG - Intergenic
1203600882 Un_KI270748v1:9559-9581 ACACACACCAGGGCCTCTCAGGG - Intergenic
1203600940 Un_KI270748v1:9790-9812 ACACACACCAGGGCCTCTCAGGG - Intergenic
1203600978 Un_KI270748v1:9944-9966 ACACACACCAGGGCCTCTCAGGG - Intergenic
1203600998 Un_KI270748v1:10021-10043 ACACACACCAGGGCCTCTCAGGG - Intergenic
1203601018 Un_KI270748v1:10098-10120 ACACACACCAGGGCCTCTCAGGG - Intergenic
1203601038 Un_KI270748v1:10174-10196 ACACACACCAGGGCCTCTCAGGG - Intergenic
1203601058 Un_KI270748v1:10251-10273 ACACACACCAGGGCCTCTCAGGG - Intergenic
1203601079 Un_KI270748v1:10328-10350 ACACACACCAGGGCCTCTCAGGG - Intergenic
1203601100 Un_KI270748v1:10405-10427 ACACACACCAGGGCCTCTCAGGG - Intergenic
1203601141 Un_KI270748v1:10559-10581 ACACACACCAGGGCCTCTCAGGG - Intergenic
1203601201 Un_KI270748v1:10789-10811 ACACACACCAGGGCCTCTCAGGG - Intergenic
1203601221 Un_KI270748v1:10866-10888 ACACACACCAGGGCCTCTCAGGG - Intergenic
1203601261 Un_KI270748v1:11019-11041 ACACACACCAGGGCCTCTCAGGG - Intergenic
1185562988 X:1074948-1074970 ACGCACACCCTCGACTCTCCTGG + Intergenic
1186154781 X:6713659-6713681 ATGCTCACTGTGGCCTCTCCTGG - Intergenic
1186160924 X:6776286-6776308 TTGCTCACCTTGGCCTCCCAAGG - Intergenic
1187208975 X:17210212-17210234 ACTCACACCCTTGCTTCTCAAGG + Intergenic
1187278632 X:17838940-17838962 AGGCAGCCCCTGCCCTCTCAGGG + Intronic
1187476953 X:19619540-19619562 CTGCCCACCTTGGCCTCCCAAGG - Intronic
1188678751 X:32975928-32975950 ATGCAATCCCTGGCCTGGCACGG + Intronic
1189120208 X:38386129-38386151 CTGCCCACCTTGGCCTCCCAAGG - Intronic
1189424510 X:40885831-40885853 CTGCCCACCTTGGCCTCCCATGG + Intergenic
1189504484 X:41597893-41597915 CTGCCCACCTTGGCCTCCCAAGG - Intronic
1189705466 X:43755252-43755274 ATGACAAGCCTGGCCTCTCAGGG + Intergenic
1190392436 X:49945695-49945717 CTGCCCGCCCTGGCCTCCCAAGG + Intronic
1191006283 X:55714577-55714599 CTGCCCACCTTGGCCTCCCAAGG - Intergenic
1191908484 X:66121879-66121901 TTACACACCAGGGCCTCTCAGGG - Intergenic
1192395791 X:70780021-70780043 CTGCACACCTCGGCCTCCCAAGG - Intronic
1192688075 X:73328293-73328315 CTACACACCATGGCCTGTCAGGG - Intergenic
1192699083 X:73448311-73448333 CTCTTCACCCTGGCCTCTCAGGG + Intronic
1192836773 X:74808158-74808180 CTGCCCACCTTGGCCTCCCAAGG - Intronic
1194057370 X:89151951-89151973 TTGCACCCCATGGCATCTCAGGG + Intergenic
1194586439 X:95740447-95740469 CTGCTCACCTTGGCCTCCCAAGG + Intergenic
1194905151 X:99566692-99566714 TTACACACCAGGGCCTCTCAGGG - Intergenic
1196704944 X:118708954-118708976 CTGCCCAGCTTGGCCTCTCAAGG - Intergenic
1196763215 X:119218952-119218974 ATGGACTCCCTGACCACTCAGGG + Intergenic
1197969696 X:132102068-132102090 ATGGACTCTCTGACCTCTCAAGG - Intronic
1198554136 X:137774916-137774938 CTGCCCACCTTGGCCTCCCAAGG + Intergenic
1198881953 X:141291468-141291490 TTGCCCACCTTGGCCTCCCAAGG + Intergenic
1200306629 X:155032217-155032239 CTGCCCACCTTGGCCTCCCAAGG + Intronic
1200657985 Y:5926908-5926930 CTGCCCACCTTGGCCTCCCAAGG - Intergenic
1201775862 Y:17665008-17665030 ATGAACAGCCTTGCCTCCCAGGG + Intergenic
1201825694 Y:18240984-18241006 ATGAACAGCCTTGCCTCCCAGGG - Intergenic