ID: 950612160

View in Genome Browser
Species Human (GRCh38)
Location 3:14133617-14133639
Sequence CTGGGCTAATCTGGACTTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 135}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950612153_950612160 13 Left 950612153 3:14133581-14133603 CCCCTGGGGGTGGACAGGACAAG 0: 1
1: 0
2: 2
3: 20
4: 209
Right 950612160 3:14133617-14133639 CTGGGCTAATCTGGACTTGCAGG 0: 1
1: 0
2: 0
3: 11
4: 135
950612154_950612160 12 Left 950612154 3:14133582-14133604 CCCTGGGGGTGGACAGGACAAGA 0: 1
1: 0
2: 4
3: 19
4: 195
Right 950612160 3:14133617-14133639 CTGGGCTAATCTGGACTTGCAGG 0: 1
1: 0
2: 0
3: 11
4: 135
950612155_950612160 11 Left 950612155 3:14133583-14133605 CCTGGGGGTGGACAGGACAAGAT 0: 1
1: 0
2: 0
3: 14
4: 149
Right 950612160 3:14133617-14133639 CTGGGCTAATCTGGACTTGCAGG 0: 1
1: 0
2: 0
3: 11
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950612160 Original CRISPR CTGGGCTAATCTGGACTTGC AGG Intronic
904470864 1:30735422-30735444 CTGGAATATTCTGGACTGGCTGG - Intronic
904533532 1:31184125-31184147 TTGGTCAAATATGGACTTGCAGG - Intronic
915886449 1:159727400-159727422 CTGACCTAATCTGGACTGGGTGG - Intergenic
916959219 1:169872331-169872353 CTTGACTAATGTGCACTTGCAGG - Intronic
919920911 1:202165925-202165947 CTGGGCTGAGCTGGTCTTGGAGG + Intergenic
920435909 1:205947095-205947117 CTGGTCTTATCTGCACCTGCTGG + Intergenic
921216062 1:212937653-212937675 CTTGGCTAATGTGGACTGGCAGG - Intergenic
1062968708 10:1629650-1629672 CGGGGGTGAGCTGGACTTGCAGG - Intronic
1063472758 10:6301536-6301558 TTGTGCTAATCTGGATTTTCAGG + Intergenic
1064303012 10:14139657-14139679 CTGGGCTAGTCTGGAATGCCTGG + Intronic
1064454475 10:15473905-15473927 CTGGGCTAATCTGGGTTCTCTGG + Intergenic
1065344904 10:24739266-24739288 CTGGGCTCAGCTGGACATGGTGG + Intergenic
1065779956 10:29158033-29158055 CTGGGCTCAACAGGACTTGTAGG + Intergenic
1070499054 10:77053287-77053309 CTGGGCAAAGCTGCACTTGCTGG + Intronic
1072475776 10:95758492-95758514 GGGGGCTAATCTAGACTTGAAGG - Intronic
1072828136 10:98629185-98629207 CTGGGCTAATCAGCCCTGGCAGG + Intronic
1076694141 10:132238997-132239019 CTGGGCCAGGCTGGACATGCAGG + Intronic
1078093121 11:8279876-8279898 CTGGGCTAGACTGGACTCGGAGG - Intergenic
1083942190 11:65902075-65902097 CAGGGGCAATCTGGACTTCCTGG - Intergenic
1084743533 11:71154403-71154425 CTGGCCAACTCTGGACTGGCTGG - Intronic
1088189328 11:107210142-107210164 CTGATCTAATCTGGACTGGTTGG + Intergenic
1090609687 11:128459574-128459596 ATGGGCAAATCTGGTCTAGCTGG - Exonic
1091038694 11:132256654-132256676 CTGGGCTTGTGTGGACTGGCAGG + Intronic
1093228747 12:16516750-16516772 CTGAGCTAATATGTACTTGCAGG + Intronic
1096271133 12:50167192-50167214 CTGGGCTGATCTGGAGGGGCCGG - Exonic
1097021099 12:56021334-56021356 CTGGGCTGAGCTGCTCTTGCTGG + Intronic
1098342175 12:69463608-69463630 CTGGGCTGATCTCGAACTGCTGG - Intergenic
1099302352 12:80913378-80913400 CTGTGCTTGTCTGCACTTGCAGG - Intronic
1099928423 12:89045955-89045977 TTGGGTAAATCTGGACTGGCTGG + Intergenic
1105721877 13:23124639-23124661 CTGGGCTATTCTGCTCTTGGGGG - Intergenic
1105793009 13:23821413-23821435 CAGGGCTCATTTGGACTTGGTGG - Intronic
1109517929 13:63468574-63468596 CTAGGCTGATCTTGAATTGCTGG - Intergenic
1112796631 13:103064159-103064181 CAGGGCTTATTTTGACTTGCTGG + Intronic
1122540717 14:102496340-102496362 CTGGGGCAAACTGGAGTTGCCGG + Intronic
1123063152 14:105603464-105603486 CTGGGCTGAGCTGGCCTGGCCGG - Intergenic
1126327719 15:47499374-47499396 CTGGTCTCATCTGGCTTTGCGGG - Intronic
1126544316 15:49855974-49855996 CTGGGCTAATCTGTAGTTTGGGG - Intergenic
1129758466 15:78112731-78112753 CTGGGCTGATCTGGCTTTGGGGG - Intronic
1131408264 15:92184356-92184378 CTGGGATAATCTGCATTTTCAGG - Intergenic
1131530294 15:93185176-93185198 CTGGGCTGATCTGGAACTCCTGG + Intergenic
1132201003 15:99954779-99954801 CTGGGCTAAGCTGGATGAGCTGG - Intergenic
1133882152 16:9792431-9792453 CTGGGCTGATCTTGACCTCCTGG + Intronic
1138612915 16:58141656-58141678 CTGGGCTGGTCTGGAATTCCTGG + Intergenic
1138649590 16:58451703-58451725 GTGGGCGACTCTGGACTTGGAGG + Intergenic
1139911434 16:70399717-70399739 CTGGGCTAATCTAGTCCTCCAGG - Exonic
1141050837 16:80761974-80761996 CTGGGCTAGTCTTGACCTCCTGG - Intronic
1142082152 16:88155168-88155190 ATGGCCCACTCTGGACTTGCAGG - Intergenic
1143106087 17:4531251-4531273 CTGGACTAATCTGGAAGGGCAGG - Intronic
1144310381 17:14008525-14008547 CTGGGCTGACCTGGAATTCCTGG + Intergenic
1147305729 17:39563224-39563246 CTGGGCCACTCTTGACTTCCAGG + Intronic
1151234391 17:72708426-72708448 CTGTGTGAATTTGGACTTGCTGG + Intronic
1151672493 17:75579113-75579135 CTTGGCTAATCTTGACATGCAGG - Intergenic
1151674255 17:75589614-75589636 CTGGGCTTGTCGGGACCTGCGGG - Intergenic
1155081254 18:22412146-22412168 CTGGGAGAATCTGAATTTGCCGG - Intergenic
1159105561 18:63999479-63999501 CTGGGCTATTTTGGCCTTGATGG + Intronic
1159884542 18:73891693-73891715 CAGGGCTCATCTGGAGATGCGGG - Intergenic
1159909825 18:74135164-74135186 CTGTGGTCATCTGGTCTTGCAGG - Intronic
1161483695 19:4523680-4523702 CTGGGCGCACCTGGACTGGCCGG - Exonic
1162339124 19:10081176-10081198 CTGGGCTGATCTTGACCTCCTGG - Intergenic
1164289595 19:23855486-23855508 GTGGGCTTATCTGGTCGTGCTGG - Intergenic
1164778318 19:30872103-30872125 CTGGGCACCTCTGGACTTGGCGG - Intergenic
1167231150 19:48284353-48284375 CTGGGCTGGTCTCGACTTCCTGG - Intronic
1167517677 19:49932708-49932730 CTTGGATACTCTGGACTTGCTGG + Exonic
1167735530 19:51292366-51292388 CTGAGCTCATCTGGCCCTGCTGG - Intergenic
926004627 2:9363781-9363803 CCAGGCTAATCTGGAATTCCTGG + Intronic
927497533 2:23560962-23560984 CAGGGCTGAGCTGGACTGGCAGG + Intronic
927848950 2:26486910-26486932 CTGGGCTACCCTTGACTGGCAGG - Intronic
931569002 2:63648336-63648358 CTGGCCAAATCTGGACTCGTTGG + Intronic
931830854 2:66049782-66049804 CTGGGCTATTCTGGAACTCCTGG + Intergenic
931933007 2:67161843-67161865 ATGAGATAAGCTGGACTTGCTGG - Intergenic
935417543 2:102834729-102834751 CTGGACTGCTCTGGACCTGCAGG - Intronic
936974180 2:118202866-118202888 CTGGGCTGACCTGGCCCTGCAGG + Intergenic
937238250 2:120443357-120443379 CTGGGCTGAGCTTGACTTGCAGG - Intergenic
946386229 2:219386105-219386127 CTGGGCTGACCTGGCCTGGCTGG - Intronic
947359705 2:229334647-229334669 CTGGGCTAATCTGGAAGAGATGG - Intergenic
948074729 2:235156879-235156901 CTGGGCTACTCTGTTCTTCCTGG - Intergenic
948250248 2:236522099-236522121 CTGGGGTAAGCTGCACTTGGTGG + Intergenic
1168896510 20:1327444-1327466 CTGGGCTAATTTGGCCTTCCAGG - Intronic
1169599436 20:7240606-7240628 CTCTGCTGATCTTGACTTGCTGG + Intergenic
1172519885 20:35559627-35559649 CTGGTGTGCTCTGGACTTGCAGG - Intergenic
1176232745 20:64040401-64040423 CTGGGCTCAGCTGGGCGTGCTGG + Intronic
1178892507 21:36531887-36531909 CTAGGCGAATCTAGACTTTCTGG - Intronic
1179722974 21:43325793-43325815 ATGGGCTCTGCTGGACTTGCTGG + Intergenic
1180605633 22:17057035-17057057 CTGGGCTCAACTGGATGTGCAGG - Intergenic
1180997058 22:19970905-19970927 CAGGGCTGATCCTGACTTGCTGG + Intronic
1181939686 22:26465516-26465538 CAGGGATAATCTGGACATTCGGG + Exonic
1182621594 22:31621463-31621485 ATGGGCTAATCTGGAAGGGCAGG + Exonic
949313975 3:2731151-2731173 CTGGGCTAATCTGAAATTTTTGG - Intronic
950117977 3:10463722-10463744 CTGGGCTACTCTGGCCAGGCCGG + Intronic
950612160 3:14133617-14133639 CTGGGCTAATCTGGACTTGCAGG + Intronic
951858739 3:27226982-27227004 GTGGGCTGATTTGGACTTGTTGG - Intronic
952137619 3:30441031-30441053 CTTGGCAAAGCTGGATTTGCAGG + Intergenic
952848908 3:37711936-37711958 TTGGGCTCATCTGTATTTGCAGG - Intronic
955100947 3:55849271-55849293 CTGGACTGATCTGGACATGTAGG + Intronic
961367791 3:126412296-126412318 CTGGGCCCACCTGGACATGCCGG + Intronic
961569435 3:127787301-127787323 CTGGACTTGGCTGGACTTGCTGG + Intronic
964662312 3:159133996-159134018 CTGAGCTCATTTGGATTTGCAGG + Intronic
967463558 3:189776043-189776065 CTAGGCTAATCTGAACCTCCTGG - Intronic
968120649 3:196123487-196123509 CCGCTCTCATCTGGACTTGCTGG - Intergenic
968896179 4:3405054-3405076 CTGTGTTAGTGTGGACTTGCTGG - Intronic
976094089 4:81489053-81489075 CTGGGCTAATCTGTGCTTACTGG + Intronic
979082789 4:116363393-116363415 CTGGGGTATTCTGGACCAGCTGG - Intergenic
979724400 4:123942824-123942846 CTGTGCTGATCTGGGCATGCTGG - Intergenic
980421321 4:132565219-132565241 CTGGGCAAAGCTGGACCTCCTGG + Intergenic
981428048 4:144626613-144626635 CTGGGCTCATCTAGAGTTGGGGG + Intergenic
982730599 4:158952034-158952056 CTGGGGTAATCTGGGATTGCTGG + Intronic
988213207 5:28235859-28235881 CTAGGCTAATCCGGAATTCCTGG - Intergenic
988649913 5:33137872-33137894 CTGAGCCATTCTGCACTTGCAGG + Intergenic
989988070 5:50726660-50726682 CTGGTCTCATGTAGACTTGCTGG + Intronic
991048250 5:62245357-62245379 CTGGGCTAGTCTGGAACTCCTGG - Intergenic
991339003 5:65584645-65584667 CTAGGCTGATCTTGACTTTCTGG - Intronic
992055883 5:72988997-72989019 CCAGGCTAATCTGGAATTCCAGG - Intronic
997301141 5:132806462-132806484 CTGGGCTTGTCTGGAACTGCTGG - Intronic
997761833 5:136456288-136456310 CTAGCCTATTCTGGACATGCTGG - Intergenic
997796896 5:136819561-136819583 CTGGGCTCATATGGTCCTGCTGG + Intergenic
998198708 5:140099654-140099676 CTGAGGTAAGCTGGACTTGGTGG - Intergenic
999154807 5:149450600-149450622 CTGGCCCAATCTGGGATTGCAGG - Intergenic
1004656152 6:17663471-17663493 CTGGGCTAGTCTTGAATTCCTGG + Intronic
1005303208 6:24490903-24490925 CTGGACTAATCAGGAGTAGCTGG - Intronic
1006496462 6:34426859-34426881 CTAGGCTAGTCTGGACCTCCTGG - Intergenic
1011667488 6:89648656-89648678 CTGGGCTACTCTTGAATTCCTGG - Intronic
1013481725 6:110558619-110558641 CTGGGCTATTCTGGCTCTGCAGG - Intergenic
1014010822 6:116473684-116473706 CTGGGCTAATCTCGAACTTCTGG - Intergenic
1018092702 6:160358774-160358796 CTGGTCTAGTCTGGGGTTGCTGG + Intronic
1019337066 7:490544-490566 CTGGGCTCCTCTGGACCTCCTGG - Intergenic
1024811699 7:53219442-53219464 CTGGGCTTAGCAGGACTCGCGGG - Intergenic
1031449003 7:121890885-121890907 CTGGGCTAGTCTTGACTTCCTGG + Intronic
1036244362 8:7103819-7103841 CAGGTCTAAGCTGGACTTGGAGG - Intergenic
1036283731 8:7424398-7424420 CTGGGCTGGCCTGGTCTTGCAGG + Intergenic
1036337740 8:7887131-7887153 CTGGGCTGGCCTGGTCTTGCAGG - Intergenic
1037511279 8:19585908-19585930 CATTGCAAATCTGGACTTGCAGG - Intronic
1042634754 8:70861439-70861461 CTAGGCTGATCTGAACTTCCTGG - Intergenic
1045464788 8:102459959-102459981 CTAGGCTAGTCTGGAATTCCTGG - Intergenic
1049738360 8:144222005-144222027 CTGGGCGAGGCTGGACATGCAGG + Intronic
1050362351 9:4842497-4842519 GTGGGCAAAGCTGGACTTTCTGG + Intronic
1051965896 9:22829457-22829479 CTTGGCAAAGCTGGAGTTGCAGG + Intergenic
1057761016 9:97874436-97874458 CTGGGCTACTCCTGACTTGCTGG - Intergenic
1059320474 9:113464524-113464546 CTGGGCAAACCTGGCCTTCCTGG + Intronic
1060824464 9:126680017-126680039 CTGGCCTATTCTGGCCATGCAGG + Intronic
1062489176 9:136796245-136796267 CTGGGCAACCCTGGAATTGCAGG - Intronic
1192239214 X:69316006-69316028 CTGGGCTAATCTCAAATTCCTGG + Intergenic
1196412079 X:115430912-115430934 CTGGGCTAATCTTGAACTCCTGG - Intergenic
1196595920 X:117545424-117545446 CAGGGCTAGGCTGAACTTGCAGG + Intergenic
1196866959 X:120078705-120078727 CTGGGCTGGTCTGGAACTGCTGG + Intergenic
1196876140 X:120157577-120157599 CTGGGCTGGTCTGGAACTGCTGG - Intergenic
1197320180 X:125019119-125019141 CTGTGCTAGCCTGGACTTGTGGG - Intergenic
1198202584 X:134436700-134436722 CTCTGCTAATCTGCTCTTGCAGG + Intergenic