ID: 950613878

View in Genome Browser
Species Human (GRCh38)
Location 3:14143944-14143966
Sequence ATGTGCTAGAAAAAGTGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 291}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950613878 Original CRISPR ATGTGCTAGAAAAAGTGGAA GGG Intronic
902091118 1:13904030-13904052 ATGTGTCAGGAAATGTGGAAAGG + Intergenic
902435456 1:16395649-16395671 ATTTGCAAGAAAAAGTGCATGGG + Exonic
904148395 1:28414677-28414699 ATATGGTACAAAAAATGGAAGGG - Intronic
906765418 1:48426502-48426524 ATGGACTAGCAAAAGTGAAATGG + Intronic
908480234 1:64532507-64532529 ATGTGTTTCAGAAAGTGGAATGG + Intronic
908608072 1:65822685-65822707 ATGTGGTAGAAGCAGCGGAAGGG - Intronic
909247067 1:73299785-73299807 ATGTGGCAGAAGAAATGGAAGGG + Intergenic
910135988 1:83970758-83970780 AAGTGCTAGAAATACTGGCAGGG + Intronic
911065655 1:93785773-93785795 ATTTGATAGAAAAAGTGTCATGG - Intronic
915449528 1:155994923-155994945 ATATACTAGGAAAAGGGGAACGG + Intronic
918942733 1:191023166-191023188 ATGTATTAGAAAAAGTCAAAAGG + Intergenic
919617225 1:199822800-199822822 TTGTGGGAGAGAAAGTGGAAAGG - Intergenic
922160013 1:223072628-223072650 ATGGGGTAGAAAAATAGGAAAGG + Intergenic
923658554 1:235939222-235939244 ATGATCAAAAAAAAGTGGAAAGG + Intergenic
923807065 1:237269018-237269040 ATATGCTATATAAATTGGAAAGG - Intronic
924290180 1:242527871-242527893 ATGTGCTGGAAAAAGTGCTGTGG - Intergenic
924508268 1:244706383-244706405 ATGTGCTACTCAGAGTGGAAGGG - Exonic
924651432 1:245931224-245931246 ATGGGCTATAAAAAGGTGAATGG + Intronic
1064969879 10:21054182-21054204 ATGAACTAGAAACAGTAGAAAGG + Intronic
1065821458 10:29529503-29529525 ATCTTCTAGAAAAACTTGAAAGG - Intronic
1066689515 10:38012275-38012297 CTGAGTTAGAAAAAGAGGAATGG - Intronic
1070079583 10:73172180-73172202 TTGTCTTTGAAAAAGTGGAAAGG - Intronic
1071022207 10:81070739-81070761 ATGTCCTAAAACAAGTGGAGAGG - Intergenic
1071233252 10:83613839-83613861 ATATGGCAGAAAAGGTGGAAGGG - Intergenic
1071280745 10:84100432-84100454 ATGTTCTAGAAAAATTAGGAAGG - Intergenic
1072257372 10:93632958-93632980 ATGAGTTAGAAAAATTAGAAAGG + Intronic
1074339991 10:112619240-112619262 ATTTGGGAGAAACAGTGGAAAGG + Intronic
1074376949 10:112949041-112949063 ATTTGCTACAAAATGGGGAATGG - Intergenic
1076527816 10:131123482-131123504 ATGTTCTAGAGACAGTGGCAAGG + Intronic
1078558508 11:12350929-12350951 TGGAGCCAGAAAAAGTGGAAAGG - Intronic
1080770693 11:35338531-35338553 TTTGGCTAGAAAAAGTGGGAAGG + Intronic
1082178471 11:49089108-49089130 ATCTGCAAGAGAAAGTGGATGGG + Intergenic
1082914844 11:58422042-58422064 ATGTGGTAGAAAAAATGCAAGGG + Intergenic
1083997441 11:66279193-66279215 ATGTGAGAGACAAAGGGGAAGGG - Intronic
1084715399 11:70870328-70870350 AGGAAATAGAAAAAGTGGAAGGG + Intronic
1085495071 11:76961590-76961612 TTATGCCAGAAAAAATGGAAAGG + Intronic
1087456925 11:98397758-98397780 ATGTGCTACAGAAAGTAGAAAGG - Intergenic
1088124546 11:106408319-106408341 AGGTGCGAGATAAAGGGGAAAGG - Intergenic
1088550890 11:111011221-111011243 ATGAGCTAAAAAAAGAGAAAGGG - Intergenic
1088895710 11:114076800-114076822 TTGTGCTAGAAAGTGAGGAAAGG - Intronic
1091903172 12:4161875-4161897 AGCTGAGAGAAAAAGTGGAATGG - Intergenic
1092902551 12:13073478-13073500 CAGTCCAAGAAAAAGTGGAAAGG - Intronic
1094455916 12:30632726-30632748 ATGTGCAGAAAAAACTGGAAAGG - Intronic
1096949310 12:55448772-55448794 ATGTACTGGAAAAAGAGGGAGGG + Intergenic
1097449434 12:59717741-59717763 ATGTGGGAGAAAAAAAGGAAAGG + Intronic
1098031428 12:66258710-66258732 ATGTGCTGGAAAAAGTCCCAGGG + Intergenic
1098756728 12:74373222-74373244 AACTGATAGAAAAAGTCGAAAGG + Intergenic
1100012139 12:89966439-89966461 ATGTGATATTAACAGTGGAAAGG + Intergenic
1101291206 12:103371545-103371567 ATGAGCTAAAATAAGTGAAAGGG + Intronic
1101688477 12:107050159-107050181 AAAAGCTAGAAAAAATGGAAAGG + Intronic
1101906984 12:108834374-108834396 AGGTGCTAGAAGATGTTGAAAGG - Intronic
1103232935 12:119347236-119347258 ACCTGCTAGAAAAAATGGAGAGG + Intronic
1106029769 13:25989633-25989655 AGGTGCTAGAAAAAAAGAAAAGG - Intronic
1107164672 13:37270515-37270537 ATATGCTAGAAAAATTGGCAAGG + Intergenic
1108254072 13:48593955-48593977 GTGAGATAGGAAAAGTGGAAAGG + Intergenic
1108867173 13:54937830-54937852 AAATGCTAGAAAAAGAAGAATGG + Intergenic
1109040639 13:57331332-57331354 TTGCCCTTGAAAAAGTGGAAGGG + Intergenic
1109174279 13:59135935-59135957 ATGAGAGAGAAACAGTGGAAGGG - Intergenic
1110254848 13:73421763-73421785 AGGTGCTACAGGAAGTGGAACGG + Intergenic
1111242880 13:85498600-85498622 ATGTGTTAGAACAAATAGAAAGG - Intergenic
1111873001 13:93857732-93857754 AAGGGCTAGAGAAAGTGGAATGG + Intronic
1112770420 13:102789033-102789055 ATCTGCTAGAAAAACTTAAATGG - Exonic
1113071283 13:106423801-106423823 ACGTGCAATAGAAAGTGGAAGGG - Intergenic
1114304911 14:21413765-21413787 AAGTAGAAGAAAAAGTGGAATGG - Intronic
1114401790 14:22417040-22417062 ATGTGCAACAAAAAGAGAAAGGG + Intergenic
1114406505 14:22462051-22462073 ATCTGCTGGAAAGGGTGGAAAGG - Intergenic
1114599039 14:23939565-23939587 ATGTGCTTGACAAAAGGGAAGGG - Intergenic
1114686021 14:24532450-24532472 ATGTGGGAGAGAAAGAGGAAAGG - Intergenic
1114804520 14:25819461-25819483 ATGTCCTAGAATGAGAGGAAGGG + Intergenic
1116522200 14:45863338-45863360 ATTTGGTAGAAACAGTAGAAAGG + Intergenic
1116634090 14:47372393-47372415 ATTTGATAGAAAAAGGGCAAAGG + Intronic
1116653440 14:47623162-47623184 ATGTGTGAGAGAGAGTGGAAGGG - Intronic
1117444832 14:55794196-55794218 ATGTGAGAGAAAAAGTGGTGGGG + Intergenic
1117462790 14:55962804-55962826 ATCTGGTAGAAAGAGAGGAAGGG - Intergenic
1117892054 14:60433349-60433371 ATGAGCTAGAAAACCTGGGAAGG - Intronic
1119442091 14:74635339-74635361 ATGTGCTGGAAGAAGAGGACAGG - Intergenic
1119705088 14:76778311-76778333 ATGTGAGAGAAAAGGTAGAAAGG + Intronic
1121502173 14:94446703-94446725 ATGTGGCAAAAAATGTGGAATGG + Intronic
1202918125 14_KI270723v1_random:3506-3528 ATGGGCCAGAAAACGAGGAAGGG - Intergenic
1124997700 15:34739869-34739891 ATGTCTTAAGAAAAGTGGAAGGG - Intergenic
1125453748 15:39836141-39836163 TTGTTCTGGAAAGAGTGGAAAGG + Intronic
1126195031 15:45922143-45922165 TTGTGCTATGAAATGTGGAAGGG + Intergenic
1126526125 15:49656647-49656669 ATTTGCTTGAGAAACTGGAAGGG - Intergenic
1129757135 15:78105328-78105350 AAGTGCTAGAAAGAGAGAAAGGG + Exonic
1130146944 15:81281593-81281615 ATGTGCTGGAAAGTGAGGAATGG - Intronic
1130437358 15:83914461-83914483 ATGTTATACAAAAAGTGGCAAGG - Intronic
1131044818 15:89305630-89305652 AGGTTCTAGAAGAAGTGGACTGG + Exonic
1134211318 16:12279819-12279841 ATGAGCTAGAGAAGGTGAAAGGG + Intronic
1135348137 16:21706641-21706663 AAGGGCCACAAAAAGTGGAATGG - Intronic
1136711336 16:32239841-32239863 ATGTTCTGGGAAAAGGGGAAAGG + Intergenic
1136756571 16:32689564-32689586 ATGTTCTGGGAAAAGGGGAAAGG - Intergenic
1136811539 16:33180809-33180831 ATGTTCTGGGAAAAGGGGAAAGG + Intergenic
1136818015 16:33290889-33290911 ATGTTCTGGGAAAAGGGGAAAGG + Intronic
1136824579 16:33347418-33347440 ATGTTCTGGGAAAAGGGGAAAGG + Intergenic
1136829645 16:33446189-33446211 ATGTTCTGGGAAAAGGGGAAAGG + Intergenic
1137033472 16:35546675-35546697 ATGGGCTAGGAAATGGGGAAAGG + Intergenic
1138426533 16:56937414-56937436 AAGTACTAGAAAAAGGGGGACGG - Intronic
1138698058 16:58834148-58834170 ATAAGCTAGGAAAAGAGGAAGGG - Intergenic
1140431557 16:74908622-74908644 ATATGCTAGCAATAGGGGAAAGG + Intronic
1140965701 16:79964000-79964022 GTATGCTAGAAAAAGCTGAAGGG - Intergenic
1202990117 16_KI270728v1_random:3778-3800 ATGTTCTGGGAAAAGGGGAAAGG + Intergenic
1203058720 16_KI270728v1_random:949918-949940 ATGTTCTGGGAAAAGGGGAAAGG - Intergenic
1144545928 17:16195680-16195702 ATGTGCTAGAATAGCTGGGAAGG - Intronic
1144589524 17:16512487-16512509 ATGAGCCAGCAGAAGTGGAAGGG - Intergenic
1144631629 17:16875887-16875909 ATGTGCATTAAAAAGTGGCATGG - Intergenic
1145300475 17:21631598-21631620 ATGTGCTAGAATAGCTGGGAAGG + Intergenic
1145349816 17:22071644-22071666 ATGTGCTAGAATAGCTGGGAAGG - Intergenic
1145978912 17:28999968-28999990 ATGTGCTAGAAGAAAGTGAAGGG + Intronic
1146019041 17:29259704-29259726 ATGGGCTAGAAACTATGGAATGG - Exonic
1146370382 17:32262455-32262477 TTGTGGTAGAGAACGTGGAAGGG - Intergenic
1147895505 17:43748642-43748664 ATGTGCTAGAAGGAGTTCAAGGG + Intergenic
1148979581 17:51560758-51560780 ATGAGCAAGAAGCAGTGGAATGG - Intergenic
1149797935 17:59538608-59538630 ATGTACTAGAAGAAGGAGAAGGG - Intergenic
1149995906 17:61405801-61405823 ATGTGCTGGGAGAGGTGGAACGG - Exonic
1203178622 17_KI270729v1_random:38702-38724 ATGGACTAGAAAGAATGGAATGG + Intergenic
1156408532 18:36806083-36806105 ATTTGCTGAAAAAACTGGAATGG + Intronic
1156444048 18:37221244-37221266 AACTTCTAGAAAAAGTGGAAGGG + Intronic
1156580454 18:38369009-38369031 GTGAGGTGGAAAAAGTGGAAAGG - Intergenic
1156673415 18:39498367-39498389 CTGTGCTATAAAAAGTGCCAGGG - Intergenic
1158069648 18:53455756-53455778 GTGTGCATGAAAAAGTAGAAGGG - Intronic
1158266024 18:55661539-55661561 ATGTGCTTCAAAAACAGGAAAGG - Intronic
1159485844 18:69056116-69056138 ATGTGATAGATTAAGTGGACAGG + Intergenic
1159718400 18:71853686-71853708 AAGTGCTAGAAATAGAGCAAGGG + Intergenic
1160119769 18:76119863-76119885 AATTACTACAAAAAGTGGAATGG - Intergenic
1161079389 19:2303025-2303047 ATGTGCTAGAAGGCGTTGAATGG - Intronic
1164314903 19:24078832-24078854 ATGTGCTTGAAAAAGCTGATGGG - Intronic
1164518217 19:28954685-28954707 ATGTTCTAGAAAAAGAGAAGTGG + Intergenic
1166444491 19:42847191-42847213 ATGATCTAGAAAGAGTGAAAGGG + Intronic
1166768042 19:45264195-45264217 TTGTGAGAGAGAAAGTGGAAAGG + Intronic
925250591 2:2433825-2433847 ATGTGATAGAGGAAGGGGAAGGG + Intergenic
925318778 2:2945256-2945278 AAATACTAGAAATAGTGGAAGGG + Intergenic
925350159 2:3195444-3195466 ATGTGAGAGAAAAAGATGAAAGG - Intronic
928728325 2:34201907-34201929 ATGACCTAGAAAAACAGGAAAGG + Intergenic
928769400 2:34688426-34688448 ATGTGTGAGACAAAGTGAAAAGG + Intergenic
929757183 2:44777456-44777478 AGTTGCTAGAAAAACTGGAAAGG - Intergenic
930858838 2:56048707-56048729 TTGTGCTTGAAAACGTAGAAAGG - Intergenic
931031749 2:58183670-58183692 ATGTTATAGAAAATATGGAAAGG - Intronic
932776627 2:74531737-74531759 ATGTGGTGGAAATAGGGGAAGGG + Intronic
934579344 2:95426198-95426220 ATGTGGACGAAAAGGTGGAAGGG - Intergenic
934600099 2:95650526-95650548 ATGTGGACGAAAAGGTGGAAGGG + Intergenic
936046370 2:109191224-109191246 ATGTGCTTAAAAAAGTGGACGGG + Intronic
936533440 2:113292526-113292548 GTGTGCACGAAAAGGTGGAAGGG + Intergenic
937079090 2:119127557-119127579 ATTTGCTAGAAAACTTGCAATGG - Intergenic
938810252 2:134846150-134846172 ATGTTCTAGGAAAAGAAGAAAGG + Intronic
939569477 2:143823644-143823666 ATAGGCAAGAAAAAGTAGAAAGG - Intergenic
940512044 2:154627845-154627867 ATTTCCTAGAAAAAGTATAATGG - Intergenic
940611705 2:156000645-156000667 ATGGGTCAGAAAATGTGGAAAGG - Intergenic
940810590 2:158238206-158238228 AAGAGCTAGAAAAAGGGGGATGG + Intronic
941073389 2:160980228-160980250 ATGTGTTAGAAAAATTAGAGGGG - Intergenic
941384392 2:164835480-164835502 AGGGGCTGGAGAAAGTGGAATGG + Intronic
943631129 2:190253758-190253780 ATGTAGTGGAAAAAGTGGTAAGG - Intronic
945046860 2:205789400-205789422 ATGGGCTAGGGAGAGTGGAATGG - Intronic
945082023 2:206095681-206095703 ATGTCCTACAAAATGTGAAAAGG - Intergenic
946341520 2:219072340-219072362 ATGGGCTAGCAAAATTGTAATGG - Intergenic
947168634 2:227288438-227288460 ATGTTTTAGGGAAAGTGGAATGG + Intronic
1169557322 20:6765247-6765269 ATCTGCCAGCAAATGTGGAAGGG - Intergenic
1170224572 20:13977586-13977608 ATGTGCAAAAAAAAGTGGAGTGG + Intronic
1170489579 20:16858928-16858950 AAGTACTAGAAAAATGGGAAAGG + Intergenic
1171432607 20:25093106-25093128 ATTTGCTAGAAAAGAAGGAAGGG + Intergenic
1171559961 20:26115091-26115113 ATGTGCTAGAATAGCTGGGAAGG - Intergenic
1171782087 20:29428166-29428188 ATGGGCCAGAAAAGGAGGAAGGG - Intergenic
1172228931 20:33323959-33323981 GAGTGCTAGAAGAAGGGGAAAGG + Intergenic
1172985080 20:38979652-38979674 ATGATCTAGGAAAATTGGAATGG + Intronic
1174205736 20:48836988-48837010 AACTGCTAGAAAAAGTGAAAAGG + Intergenic
1177488394 21:21789640-21789662 ATGTTATAGAAAAAATGAAAGGG + Intergenic
1178074048 21:28999396-28999418 GTGTGGTAGATGAAGTGGAATGG - Intergenic
1178566037 21:33686674-33686696 ATGTGATATATAAAATGGAAAGG - Intronic
1178750485 21:35297891-35297913 ATGTGAAAGAGAAAGAGGAAGGG - Intronic
1179151701 21:38814729-38814751 ATGAGGTAAAAACAGTGGAAAGG - Intronic
949156855 3:838055-838077 ATGTGCTAAAAAAAAGAGAAGGG + Intergenic
949261025 3:2102932-2102954 TTCTGGTAGAAAAACTGGAATGG + Intronic
949341158 3:3032537-3032559 ATGTGCAAGAAAAGCTGCAAGGG - Intronic
950613878 3:14143944-14143966 ATGTGCTAGAAAAAGTGGAAGGG + Intronic
951304677 3:21043794-21043816 ATGTGATTGGAAATGTGGAAGGG + Intergenic
951649866 3:24939307-24939329 ATATGCTAGAAAGAATTGAAAGG - Intergenic
951669208 3:25161655-25161677 ATGTACTAAGAAAAGTGGGAAGG - Intergenic
952917086 3:38254846-38254868 ATGGGCTAGAGAAAGTGAACAGG - Exonic
953590585 3:44249015-44249037 ATGTGCTTGGAAATGTGTAATGG + Intronic
956482651 3:69688527-69688549 ATGTGCCAGACAATGTGCAAAGG + Intergenic
956980569 3:74632405-74632427 ATGTGGTAGAAAGATTGGAAAGG - Intergenic
957083400 3:75658233-75658255 ATGGGCTAGAAAAGGAGGAAGGG + Intergenic
958535153 3:95392128-95392150 AAGTGTTTGAAAAACTGGAAAGG + Intergenic
958758551 3:98278994-98279016 AAGGGACAGAAAAAGTGGAAAGG - Intergenic
959384131 3:105680511-105680533 GTGTGCAGGAAGAAGTGGAAGGG + Intronic
960506505 3:118500965-118500987 AAGTGCTCTAAAAAGGGGAAGGG + Intergenic
961229520 3:125290936-125290958 ATTTGCAAGAAAAAGTTAAAAGG - Intronic
961913389 3:130344946-130344968 ATGTGTTAGAAAGAGTGGGTTGG - Intergenic
963377902 3:144493823-144493845 ATGAGCTAGAAGAATAGGAATGG - Intergenic
965496981 3:169411097-169411119 ATATGCTAACAAATGTGGAAAGG + Intronic
965910057 3:173763370-173763392 CTGTGCTAGACAAAATGTAAGGG + Intronic
966666543 3:182478049-182478071 CTGTGCTATTTAAAGTGGAATGG - Intergenic
966895547 3:184442042-184442064 AAGTGGTAGAAAATCTGGAAGGG - Intronic
967129645 3:186458632-186458654 ATGTGCCAGAAAACGGGGAGGGG + Intergenic
968223601 3:196957916-196957938 AGGAGATAGAAATAGTGGAAGGG + Intronic
968841239 4:3007433-3007455 ATGTGCAAGACACAGTGGAAGGG - Intronic
969385733 4:6845927-6845949 ATGAGGTAGAAACAGTGCAAGGG + Intronic
971246155 4:24930055-24930077 ATGTCCAGGAAAAAGAGGAAAGG - Intronic
972813369 4:42614932-42614954 AAGTGCTATAAAAATTGGTAAGG - Intronic
975234932 4:71982637-71982659 ATGTGATAGAAAATGGGCAATGG - Intergenic
976567205 4:86564679-86564701 AGGTGGTAGAAAAGGAGGAAGGG - Intronic
978446807 4:108787899-108787921 ATGTGCAAGAAAAAGCGGGAAGG + Intergenic
978829194 4:113062773-113062795 CTGTGCTTGAAAAGGTGCAAGGG - Intronic
978838387 4:113181350-113181372 ATGAGCTAGGAAGAGTGGAGTGG - Intronic
978859722 4:113433850-113433872 ATGTGCAAGCAAAAGTGAAAGGG + Intergenic
979525775 4:121714985-121715007 ATGTGTTAGAAAATTTGGCAAGG + Intergenic
979654629 4:123177795-123177817 ATGTGGTTGAAACACTGGAAAGG - Intronic
979855929 4:125634604-125634626 AGCTGCTAGAAAAAATGTAAAGG + Intergenic
980543534 4:134227226-134227248 GAGTGCTAGAAAAGGAGGAAAGG + Intergenic
980723107 4:136722366-136722388 TTGTGCTAAAAAAAGAGAAAGGG - Intergenic
983106375 4:163691548-163691570 AAGTGCTGGAAAAAGGTGAAAGG + Intronic
984125840 4:175809167-175809189 ATGTTCTAGAAACAGTTGCATGG + Intronic
985219168 4:187684514-187684536 ATGTGTAGGAAAAAGTGGTAGGG - Intergenic
987885102 5:23802331-23802353 ATTTGCTAGTAGAAATGGAAGGG - Intergenic
989346570 5:40436854-40436876 TTGAGCTCAAAAAAGTGGAAAGG - Intergenic
990273368 5:54170075-54170097 ATTTCCTACAAAAAGTAGAAAGG - Intronic
990638941 5:57761160-57761182 ATGTCCTTGAATAGGTGGAAAGG + Intergenic
990649124 5:57878300-57878322 AGATGTTAGAAAAAGTTGAAAGG - Intergenic
990681407 5:58248676-58248698 ATGTGATAGATAAAGCTGAAGGG - Intergenic
990989799 5:61673776-61673798 AAATGCTAGAAATAGAGGAAAGG + Intronic
992389129 5:76314326-76314348 CTGTGATGGAAGAAGTGGAAAGG - Intronic
992957257 5:81922602-81922624 GTGTGTAAGCAAAAGTGGAAGGG + Intergenic
993159369 5:84269215-84269237 ATTTGCTGAAAAAAGTGAAATGG - Intronic
993626558 5:90231932-90231954 ATGTCGTAGAAAAAGTGGAAGGG + Intergenic
995730317 5:115232806-115232828 ATGTGCAAGTCAAAGTGGCAGGG + Intronic
996865031 5:128110738-128110760 ATCTGCTAGAAAAACTTAAATGG + Intronic
997575014 5:134968124-134968146 ATGTGCTAGTAGAAGTGTGAGGG + Exonic
997847429 5:137300745-137300767 AACTGCTAGAACAACTGGAAAGG - Intronic
998167265 5:139851452-139851474 AGGTCCTAGAAAAGGTGAAATGG - Intronic
998908256 5:146930126-146930148 ATGTGATAGAAAGAGTGGAATGG + Intronic
999118171 5:149183350-149183372 AGCTGGAAGAAAAAGTGGAAGGG - Intronic
999379220 5:151108642-151108664 CTGTGCCTGAGAAAGTGGAAGGG + Intronic
1000605558 5:163323763-163323785 AAGCACTAGAAAAAGTGAAAAGG + Intergenic
1000781265 5:165484909-165484931 ATATGCTAGAAATATTGAAAAGG - Intergenic
1002039034 5:176497246-176497268 ATGTAAAAAAAAAAGTGGAATGG + Intronic
1003809543 6:9764478-9764500 ACATGCTAGATAAAGTGGAAAGG + Intronic
1003970343 6:11293111-11293133 ATTTGCTGTAAAAAGGGGAAGGG + Intronic
1005144349 6:22670644-22670666 AAGAGGTAGAAAAAGAGGAAGGG - Intergenic
1005190611 6:23217919-23217941 ATCTGCTTGAAAAAAGGGAACGG - Intergenic
1005683964 6:28234043-28234065 ATGTGATAGAAAAACTCTAAGGG - Intergenic
1005815545 6:29549170-29549192 ATGTCCCTGAATAAGTGGAAAGG + Intergenic
1005873502 6:29994703-29994725 ATGGGCTAGAAAAAGGGAAAGGG - Intergenic
1006037141 6:31222799-31222821 ATGGGCTAGAAACAGAGAAAGGG + Intergenic
1007312242 6:40955636-40955658 ATGGGATAGAAAAACTGGACGGG - Intergenic
1008815878 6:55565716-55565738 ATGTTCTAGAAAATATTGAAAGG - Intronic
1008955868 6:57214680-57214702 ATGTGCTCCAAAAACAGGAAGGG - Intronic
1009266155 6:61557308-61557330 ATTTACTAGAAAAATTGGATGGG - Intergenic
1009758669 6:67975874-67975896 ATGTTCTAGGAAAAGTGTTAAGG + Intergenic
1009841898 6:69088107-69088129 AGGTGTTGGAAAAAGTGAAATGG - Intronic
1010324761 6:74551264-74551286 ATGTGATAAAAAATCTGGAATGG - Intergenic
1010965616 6:82203948-82203970 ATGAACTAGAAAAAATGGACAGG + Intronic
1011232540 6:85178868-85178890 ATGGGTAAGAAAAAGTGGGAAGG - Intergenic
1011821755 6:91261271-91261293 CTGGACTAGAAAAAGTGGAGAGG + Intergenic
1012703521 6:102493900-102493922 AAGTGAAAGAAAAAGAGGAAAGG - Intergenic
1012704773 6:102509641-102509663 ATTTGCTAGAAAAAGTTGGCCGG + Intergenic
1013932678 6:115553477-115553499 ATGGGCTAGAGAGAATGGAATGG - Intergenic
1014020574 6:116583743-116583765 ATGTGCTAATAAAAGAAGAAAGG + Intronic
1014804119 6:125810085-125810107 ATGAGCTAGAAAAAGTAGTCCGG + Intronic
1014804289 6:125811893-125811915 ATGAGCTAGAAAAAGTAGTCCGG - Intronic
1014997476 6:128168360-128168382 AGGTGCTACAAAAAATGAAAAGG + Intronic
1017300572 6:152852778-152852800 ATATGATAGAAAAAGTAGAGAGG - Intergenic
1017869646 6:158476089-158476111 CTGTGCTAGAAAAACGGGGAAGG - Intronic
1021206369 7:17786427-17786449 ATGGGCTAGAAAAGGAGAAAGGG + Intergenic
1021371528 7:19854558-19854580 CTCTGTTAGAAAAAGTGGCATGG - Intergenic
1021445121 7:20724852-20724874 TTGTGCAAAAAAAGGTGGAAAGG - Intronic
1022032379 7:26504076-26504098 ATGTCCTAGAAAAGGAGAAAGGG - Intergenic
1022970840 7:35515433-35515455 AGGGGCTGGAAAAAGGGGAATGG - Intergenic
1023456528 7:40344795-40344817 ATGTGTTACATAAAGAGGAAAGG - Intronic
1023622442 7:42087094-42087116 ATGTTCTAGGAAAGGTGAAAAGG + Intronic
1025016124 7:55440406-55440428 CTTTGCTAGAAAAAGTAAAACGG - Intronic
1025277765 7:57598690-57598712 ATGTGCTAGAATAGCTGGGAAGG + Intergenic
1033874818 7:145802652-145802674 ATGTCCTAAAAGAAATGGAAAGG + Intergenic
1033959881 7:146901841-146901863 ATATGCAAGAAAAACTGTAAAGG - Intronic
1035718147 8:1769680-1769702 AAGTTCTTGAAAAACTGGAAGGG - Intronic
1037108102 8:15135425-15135447 ATGTGCTAGGAAAATGTGAATGG - Intronic
1041442789 8:57915607-57915629 ATGTGGAAGATAAAGTGAAAAGG + Intergenic
1041612035 8:59862289-59862311 ATGTGCTAAAAAAAAGGGAGTGG + Intergenic
1041657164 8:60364589-60364611 ATGTCCTATTCAAAGTGGAAGGG + Intergenic
1041659346 8:60386176-60386198 ATGAGCTAGAAAAATTGGTATGG + Intergenic
1043242960 8:77959561-77959583 ATGAGATAGAAAAAGGGGAGGGG - Intergenic
1044269779 8:90228317-90228339 TTCTGCTAGAAAGAGTGGAAAGG + Intergenic
1044514051 8:93117960-93117982 ATGTCATAGAAAAAGAGGACAGG + Intergenic
1045066246 8:98448471-98448493 CTGTCATAGAATAAGTGGAAAGG + Intronic
1046629793 8:116612072-116612094 CTGTGTTAGAAAAAATGGAGAGG - Intergenic
1047002263 8:120584806-120584828 GTGTGCTAATAAAAGGGGAAAGG + Intronic
1047068637 8:121316734-121316756 ACATGCTAGAAAAGGTAGAAAGG + Intergenic
1048809099 8:138268985-138269007 ATGTGAAAGAAAAAGAGGAGGGG + Intronic
1049024140 8:139977183-139977205 ATGTGCCAGAACAGGTGTAACGG + Intronic
1051216657 9:14804770-14804792 ATGTGCCAACAAAAGAGGAAAGG + Intronic
1051493605 9:17694730-17694752 ATGTGCCAGTAAAATGGGAATGG + Intronic
1051786849 9:20754133-20754155 ATGTACTTGAAAAAATGGAAAGG + Intronic
1052011692 9:23418247-23418269 ATGTGTAAGAAAACGTGGAATGG + Intergenic
1052125608 9:24770947-24770969 ATGTGGTAGAACAAGTTGTATGG + Intergenic
1052642970 9:31193012-31193034 ATGTGGTAGAATAAGGGGAATGG - Intergenic
1053111820 9:35467552-35467574 ATGTGGGAGGAAAAGTGAAATGG - Intergenic
1055147187 9:72950089-72950111 ATATTCTGGAAAAACTGGAAAGG + Intronic
1057617499 9:96605005-96605027 ATTTGTTAGAAGCAGTGGAAAGG - Intronic
1057816104 9:98296209-98296231 ATGTGGCAGAAGGAGTGGAAGGG - Intronic
1058406765 9:104685351-104685373 ATTTGCCAGAAAAAATGGCATGG + Intergenic
1059547982 9:115198134-115198156 GGGTGCCAGAAAAAGAGGAAGGG - Intronic
1059566004 9:115383339-115383361 AAATGCTGGCAAAAGTGGAAAGG + Intronic
1059770446 9:117418779-117418801 ATTTGCTAGAAAGACTGGAAAGG - Intergenic
1061206787 9:129168812-129168834 CAGTGCTAGAAAAATTGGTAAGG - Intergenic
1186165875 X:6825437-6825459 ATGTGCTAGATGTAGTGAAAAGG + Intergenic
1186452966 X:9688429-9688451 TTGTGATGGAAAAAATGGAACGG - Intronic
1186815444 X:13233184-13233206 AGCTGCTATAAAAAGAGGAAGGG - Intergenic
1187068623 X:15865853-15865875 ATATGGAGGAAAAAGTGGAAAGG + Intergenic
1189070795 X:37861845-37861867 AGGTTCTAGAAAAAGTGAGATGG + Intronic
1190487420 X:50941806-50941828 ATGTGACAGAAACAGTGGCAGGG - Intergenic
1192156636 X:68751729-68751751 ATATGGTAGAAAGGGTGGAAGGG - Intergenic
1192292473 X:69811941-69811963 ATGTGGGACAAAAAGGGGAAGGG + Intronic
1193041605 X:77009674-77009696 ATGTGATCCAAAGAGTGGAAGGG - Intergenic
1193699525 X:84744422-84744444 AAATGCTAGAAAAAGAAGAATGG - Intergenic
1195495267 X:105524124-105524146 ATGAGCAAGAAATAGAGGAAAGG + Intronic
1195854342 X:109314014-109314036 ACATGGCAGAAAAAGTGGAAGGG + Intergenic
1196686488 X:118514666-118514688 ATGTGTTTGAAAAAGTGTGATGG - Intronic
1202044840 Y:20727651-20727673 TTGTGATTGAAAAAATGGAAGGG - Intergenic