ID: 950615424

View in Genome Browser
Species Human (GRCh38)
Location 3:14154131-14154153
Sequence GAAAGTAACAAGTGTCAGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1181
Summary {0: 1, 1: 1, 2: 38, 3: 267, 4: 874}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950615423_950615424 5 Left 950615423 3:14154103-14154125 CCGTTAAAATGGCTATTAACAAA 0: 1
1: 7
2: 55
3: 333
4: 1263
Right 950615424 3:14154131-14154153 GAAAGTAACAAGTGTCAGTGAGG 0: 1
1: 1
2: 38
3: 267
4: 874
950615420_950615424 16 Left 950615420 3:14154092-14154114 CCATTTCACACCCGTTAAAATGG 0: 1
1: 8
2: 414
3: 14482
4: 8493
Right 950615424 3:14154131-14154153 GAAAGTAACAAGTGTCAGTGAGG 0: 1
1: 1
2: 38
3: 267
4: 874
950615422_950615424 6 Left 950615422 3:14154102-14154124 CCCGTTAAAATGGCTATTAACAA 0: 2
1: 70
2: 649
3: 2549
4: 6753
Right 950615424 3:14154131-14154153 GAAAGTAACAAGTGTCAGTGAGG 0: 1
1: 1
2: 38
3: 267
4: 874

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950615424 Original CRISPR GAAAGTAACAAGTGTCAGTG AGG Intronic
900380111 1:2379735-2379757 GAAAATAACCAGTGTTGGTGAGG + Intronic
900535649 1:3175872-3175894 GAAAGTCAGAAGTGGGAGTGAGG + Intronic
900912786 1:5613730-5613752 GACAATAACAAGTGTTGGTGAGG - Intergenic
901410575 1:9080461-9080483 GAAAATAACAAGTGCTGGTGAGG - Intronic
901950268 1:12739642-12739664 GAAAATAACAAGTGTTGGTGAGG + Intergenic
901951677 1:12754364-12754386 GAAAATATCAAGTGTTGGTGAGG + Intronic
902106756 1:14043588-14043610 GAAAATAACAAGTGTTGGAGAGG - Intergenic
902442781 1:16441763-16441785 GAAAGTAACAAGAGGAAATGTGG - Intronic
903116957 1:21186205-21186227 GAAAATAACAAGTGTTGGTGAGG - Intergenic
903269756 1:22180118-22180140 GAAAATAACAAGTGTTGGTGAGG + Intergenic
903611145 1:24613869-24613891 GACAATAACAAGTGTTAATGAGG - Intergenic
903922241 1:26808350-26808372 GAAAATAACAAATGTTGGTGAGG - Intergenic
903939487 1:26919478-26919500 GAAAGAAACAAGTTTATGTGTGG - Intronic
904333113 1:29778562-29778584 GAAAATAACAAGTGGTAGTGAGG - Intergenic
904628997 1:31827533-31827555 GACAGTACCAGGTGTCAGAGAGG - Intergenic
904636842 1:31888551-31888573 AAAAGTAACAAGTGTTGGCGAGG - Intergenic
905123173 1:35697980-35698002 GATAATAACAAGTGTTGGTGAGG - Intergenic
905505158 1:38473269-38473291 GAAAATAACAAGTGCTGGTGAGG + Intergenic
905714656 1:40138221-40138243 GAAAATAACAAGTTTTGGTGAGG + Intergenic
905836692 1:41129978-41130000 GAAAATAACAAGTGTTGATGAGG - Intronic
905955284 1:41988557-41988579 AGAAATAACAAGTGTTAGTGAGG + Intronic
906386236 1:45371096-45371118 GAAAATAACAAGTATTGGTGAGG + Intronic
906466349 1:46083773-46083795 GATAATAACAAGTGTTGGTGAGG + Intronic
906745461 1:48218642-48218664 GAAAATAACAAGTGTTGGTGAGG - Intergenic
906765876 1:48432623-48432645 GAAAACAACAAGTGTTGGTGAGG + Intronic
906813927 1:48858172-48858194 GATAATAACAAGTGTCAGAGAGG + Intronic
907834956 1:58100019-58100041 GACAGAAAGAAGTGTCAGGGTGG - Intronic
908709386 1:66998024-66998046 GAAAATAACAAGTGTTGGTGAGG + Intergenic
908771502 1:67600994-67601016 GGAAATAACAAGTGTCAGCAAGG - Intergenic
908810837 1:67980709-67980731 GAAGATAACAAGTGTTAGTAAGG + Intergenic
909041797 1:70662184-70662206 GAAAATAACAAGGGTTGGTGAGG - Intergenic
909150631 1:71999105-71999127 GAAATTGACATCTGTCAGTGAGG - Intronic
909706825 1:78595263-78595285 GAAAATAACAAGTGGTAGTGAGG + Intergenic
910305376 1:85756558-85756580 GAAAATAACAAGTGTTGGTGAGG + Intronic
910414103 1:86979855-86979877 GAAAATAACAAGTGTTAGCAAGG - Intronic
910420913 1:87061884-87061906 GAAAATAACAAATGTTAGTGAGG - Intronic
910878519 1:91901148-91901170 GAAAATAACAAGTGTTGGTGAGG - Intronic
910993905 1:93083724-93083746 GACAATAATAAGTATCAGTGAGG - Intronic
911008771 1:93255885-93255907 GAAAGTAAAACTTGTCACTGGGG - Intronic
911442278 1:97941956-97941978 GACAATAACAAGTGTTAGTGAGG - Intergenic
911506793 1:98762848-98762870 GATAGTAACAAGTATTGGTGAGG - Intergenic
911586809 1:99700709-99700731 GAAAATAACAAGTGCTGGTGAGG - Intergenic
912179890 1:107207130-107207152 GACAGTCTCAAGTGTCACTGTGG + Intronic
912586277 1:110769381-110769403 GAAAATAACAAGCGTCGATGAGG - Intergenic
912603926 1:110968328-110968350 AAAAATAACAAATGTCAGTTAGG + Intergenic
912633806 1:111271822-111271844 GAGAGCAGCAAGTGTCATTGGGG - Intergenic
913174088 1:116257927-116257949 GAAAATAACAAGTGTCAGTGAGG + Intergenic
913344130 1:117791111-117791133 TAAAATAACAAGTGTTGGTGAGG - Intergenic
913354312 1:117901515-117901537 GACAATAACAAGTGTTGGTGAGG - Intronic
913541394 1:119824442-119824464 GAAAATAACCAGTGTTGGTGAGG + Intergenic
914215335 1:145621921-145621943 GAAAATAACAAGTGTTGGCGAGG + Intronic
914467286 1:147942306-147942328 GAAAATAACAAGTGTTGGCGAGG + Intronic
915022379 1:152793164-152793186 GAAAATAACAAGTGTTGGTGAGG + Intronic
915184225 1:154090834-154090856 GAAAATAACAAGTGTTGGTGAGG + Intronic
915380712 1:155437441-155437463 GAAAATAGCAAGTGTTGGTGAGG + Intronic
915558194 1:156671389-156671411 GAGAGTACCAAGAGTCACTGAGG - Exonic
915613135 1:157011822-157011844 GAAAATAACAAGTGTTGGTGAGG + Intronic
915711245 1:157900984-157901006 AAAAATAACAAGTGTTGGTGAGG - Intergenic
915780059 1:158538272-158538294 GATAGTAACAAGCGTCAGTGAGG - Intergenic
915804737 1:158833998-158834020 GAAAATAACCAGTGTTGGTGAGG - Intronic
916352705 1:163869803-163869825 GAAAATAACAAGGGTTGGTGAGG + Intergenic
916364772 1:164013287-164013309 AAAGATAACAAGTGTCAATGAGG + Intergenic
916546100 1:165805946-165805968 AAAAATAACAAGTGTTAGTGAGG + Intronic
916599622 1:166279390-166279412 GAAAATAACAAGTGTTGGTGAGG - Intergenic
916721972 1:167491160-167491182 GAAAATCACAAGTGTTGGTGAGG + Intronic
916772315 1:167923053-167923075 AAAAGTAACAAGTGTTGGTGAGG + Intronic
916822739 1:168415415-168415437 AAAGGTAAGTAGTGTCAGTGAGG - Intergenic
916975289 1:170071079-170071101 GAAAATAACAGGTGTTAGTGAGG + Intronic
917865930 1:179195370-179195392 GAAAATAACAAATGTTGGTGAGG + Intronic
918371565 1:183866780-183866802 GAAAGTAGCCTGTGGCAGTGTGG + Intronic
918493016 1:185103015-185103037 GAAAATAACAAGTGTTACAGAGG - Intergenic
919416602 1:197318337-197318359 GAAGATAACAAGTGTTGGTGAGG + Intronic
919585949 1:199440450-199440472 GACAATAACAAATGTCAGTGAGG + Intergenic
920283786 1:204864514-204864536 AAAAATAACAAGTGTTGGTGAGG - Intronic
920923876 1:210323220-210323242 AAAAATAACAAGTGTTGGTGAGG + Intergenic
920958113 1:210638039-210638061 GAAAATAACAACTGTTGGTGAGG + Intronic
921197611 1:212774672-212774694 GACAGTAACAAGAGTTGGTGAGG + Intronic
921379643 1:214511511-214511533 GAAAATAACAAGTGTTGGCGAGG + Intronic
921681561 1:218038992-218039014 GAAAGTAACAAGTGTTGAAGAGG + Intergenic
921683056 1:218056894-218056916 GAAAATAAGAAGTGTTAGTGAGG - Intergenic
921900555 1:220445646-220445668 GAAAATAACAAATGTCAATGAGG - Intergenic
921956221 1:220985743-220985765 GAAAAAAACAAGTGTTGGTGAGG - Intergenic
922602644 1:226869063-226869085 GAAAATAACAAGTGTTGGTGAGG + Intergenic
922655254 1:227376616-227376638 GACTATAACACGTGTCAGTGAGG - Intergenic
922985514 1:229863380-229863402 GAAAACAACAAGTGTTGGTGAGG - Intergenic
923011306 1:230090042-230090064 GAAAATAACAAGTATTGGTGAGG - Intronic
923100531 1:230811154-230811176 AAAAATAACAAGTGTTGGTGAGG - Intergenic
923138180 1:231136757-231136779 GAAAATAACAAGCATCGGTGAGG - Intergenic
923299235 1:232625964-232625986 AAAAGAAAAAAGTGTCTGTGTGG + Intergenic
923332501 1:232938516-232938538 GAAAATAACAAGTGTTGATGAGG - Intergenic
924028127 1:239859238-239859260 GAACATAACAAGTATTAGTGAGG - Intronic
924371763 1:243358453-243358475 GATAATAACAAGTGTCGGTGAGG + Intronic
924484742 1:244470506-244470528 GATAATAACAAGTGTTCGTGGGG + Intronic
1062943442 10:1441367-1441389 GAAAGAAAGAAGAGTTAGTGTGG + Intronic
1063133019 10:3194872-3194894 CAGAGTAACAAATTTCAGTGAGG - Intergenic
1063226614 10:4020926-4020948 GAAAATAACAGGTGTTGGTGAGG - Intergenic
1063742952 10:8844987-8845009 GAAAATAAGAAGTGTTGGTGAGG + Intergenic
1063996020 10:11620449-11620471 GAAAATAACAAGTGGTGGTGGGG - Intergenic
1064008825 10:11718994-11719016 GAAGATAACAAGTGTTGGTGAGG - Intergenic
1064810402 10:19191338-19191360 GAAGTTAACAAGTGTTGGTGAGG + Intronic
1064852624 10:19726442-19726464 GAAAATAACAAGTGTTGATGAGG + Intronic
1065074142 10:22060154-22060176 GAAAATAACAAGTGTTGGTGAGG - Intergenic
1065104309 10:22365908-22365930 GAAAATAACAAGTGTTGGTGAGG + Intronic
1065335431 10:24652757-24652779 GACAACAGCAAGTGTCAGTGAGG + Intronic
1065386198 10:25135579-25135601 GAAAATAACAAGTGTTGGTGAGG - Intergenic
1065415577 10:25481771-25481793 GAAAATAACAAGTCTTGGTGTGG - Intronic
1065709952 10:28506565-28506587 GAAAATAACAAGTGTTGGTGAGG - Intergenic
1065758482 10:28958342-28958364 AAAAATAACAAATGTTAGTGAGG + Intergenic
1065980876 10:30895845-30895867 GAAAATAACAAATGTTGGTGAGG + Intronic
1065990880 10:31008914-31008936 GCAGATAACAAGTGTTAGTGAGG - Intronic
1066039938 10:31538755-31538777 GAAAATAACAAGTGTTGGTGAGG - Intergenic
1066143985 10:32537149-32537171 AAAAGTAACAGATGCCAGTGAGG - Intronic
1066559632 10:36655672-36655694 GAAAATAAAAAGTGTTGGTGAGG + Intergenic
1066568450 10:36745802-36745824 GAAAATAACAAGTGTTAGTGAGG + Intergenic
1067291764 10:44948736-44948758 GAAAGGAACATGTTTCAATGTGG - Intergenic
1067760014 10:49037952-49037974 GAAACCAACAAGTGTTGGTGAGG + Intronic
1068041935 10:51835880-51835902 AAACATAACAAGTATCAGTGAGG - Intronic
1068491497 10:57730243-57730265 AAAAGTAACAGATATCAGTGAGG - Intergenic
1069043979 10:63723302-63723324 GAAAATAACAAGTGTTGGTGAGG - Intergenic
1069555805 10:69397300-69397322 GAAAATAACAAGTGTTGGCGAGG - Intronic
1069840503 10:71336626-71336648 GAAAGGAACAAGCAGCAGTGAGG + Intronic
1070041006 10:72779770-72779792 GAAAATAACAAGTGTTAGTGAGG + Intronic
1070057172 10:72946588-72946610 GACAATAGCAAGTGTTAGTGAGG - Intronic
1070214789 10:74365856-74365878 TAAAATAACAAGAGTTAGTGAGG - Intronic
1070387690 10:75940556-75940578 GAAAGTGCCAAGTGCCAATGTGG - Intronic
1070460528 10:76664675-76664697 AAAAATAACAAGTGTTAGTGAGG + Intergenic
1070530935 10:77336862-77336884 GAAAGGAACAAGTGTGATGGAGG + Intronic
1070625998 10:78051711-78051733 GATAATAACAAGTGTCAGGAAGG - Intronic
1070703583 10:78620912-78620934 GAAAATAACAAGTGTTGGTGAGG - Intergenic
1070916464 10:80158265-80158287 GAAAGGACCAAGAGTCAGAGGGG + Intronic
1070943504 10:80368483-80368505 CAAAATAACAAGTGTTGGTGAGG - Intergenic
1071673492 10:87633636-87633658 GACAGTAACAAGTGTGGGGGAGG + Intergenic
1071902221 10:90132979-90133001 GAAAATAACAAGAATTAGTGAGG - Intergenic
1072919211 10:99561500-99561522 GAAAATAACAAGTATTGGTGAGG + Intergenic
1074055447 10:109919471-109919493 GACAGTAACAAGTGCGGGTGAGG + Intronic
1074174568 10:110984152-110984174 GAAAATAACAAGTACTAGTGAGG - Intronic
1074444359 10:113506823-113506845 GGAAATAACAAGTGTTGGTGAGG - Intergenic
1074547331 10:114411352-114411374 GAAAATAACAACTGTTGGTGAGG - Intergenic
1075019362 10:118939293-118939315 GAAAATAACAAGTGTGGGTGAGG + Intergenic
1075096372 10:119474210-119474232 GAGAGAACCAAGTGGCAGTGGGG + Intergenic
1075174622 10:120147926-120147948 GAAACTAACAAATGTTGGTGAGG - Intergenic
1075360236 10:121825675-121825697 GAAAATAACAAGTGCTGGTGAGG + Intronic
1075383353 10:122036929-122036951 CAAAGTAACAAGTATTGGTGAGG - Intronic
1075525343 10:123180125-123180147 GAAAATAGCAAGTGTAGGTGAGG + Intergenic
1075958016 10:126541691-126541713 GAAAATAACAAGTGTTGGTGAGG + Intronic
1076008376 10:126966536-126966558 AAAAATAACAAATGCCAGTGAGG - Intronic
1076098904 10:127758007-127758029 GAAAGAAAGAAATGGCAGTGAGG + Intergenic
1076743592 10:132500700-132500722 GAAAATAACAATTGTTGGTGAGG + Intergenic
1077598086 11:3551776-3551798 GAAAATAACAAGTGTTGGTGAGG + Intergenic
1077660357 11:4062794-4062816 GACAGTAACAAGTGTTGGTGAGG + Intronic
1077971237 11:7193201-7193223 TGAAATAACAAGTGTTAGTGAGG - Intergenic
1078126930 11:8575092-8575114 GAAAATGACAAGTGTTGGTGAGG + Intronic
1078166298 11:8888921-8888943 AAAAGTAACAAATGTTGGTGAGG + Intronic
1078189634 11:9081981-9082003 GAAAATAATAAATGTCTGTGAGG - Intronic
1078300071 11:10120590-10120612 GAAAACAACAAGTGTTACTGAGG - Intronic
1078606511 11:12781661-12781683 GACAATAACAAGTGTTAGGGAGG + Intronic
1078607624 11:12790851-12790873 GACAATAACAAGTGTTGGTGAGG + Intronic
1078872222 11:15358369-15358391 AAATGTAACAAGTGTTGGTGAGG + Intergenic
1079107690 11:17582613-17582635 GAAAACACCAAGTGTTAGTGAGG - Intronic
1079222947 11:18580191-18580213 GAAAATAACAAGTGTTGGAGAGG + Intronic
1079335942 11:19570779-19570801 GAAAATAACAAGTGTTTCTGAGG + Intronic
1079839437 11:25377480-25377502 GAAAGAAACCAGTGTAAGTACGG + Intergenic
1080074017 11:28126597-28126619 GAAATTAAAAAATGGCAGTGAGG + Intronic
1080747561 11:35122145-35122167 GAAAGTAATAAGTGTTGGTGAGG - Intergenic
1080972518 11:37295331-37295353 GAAAATAACAAGAGTTGGTGAGG - Intergenic
1081750037 11:45503503-45503525 GATAATAACAAGTGTTGGTGAGG - Intergenic
1082180699 11:49115469-49115491 GAAAATACTAAATGTCAGTGAGG + Intergenic
1083117838 11:60480840-60480862 GAAAGTAACAAGTGTTGGTGAGG - Intergenic
1083126387 11:60571219-60571241 GAAGGAAACAAGTGTTGGTGAGG + Intergenic
1083345269 11:61985360-61985382 AAAATTATCAAGTGTCAGTGAGG - Intergenic
1083348128 11:62008212-62008234 GAAAATAACAAGTGTTGGTGAGG + Intergenic
1083862663 11:65431556-65431578 GAAAATAACAAGTGTTGGGGAGG - Intergenic
1084254169 11:67927686-67927708 GAAAATAACAAGTGTTGGTGAGG + Intergenic
1084763086 11:71286476-71286498 GAGAATAACAAGTGTCAGCGAGG - Intergenic
1084818708 11:71668236-71668258 GAAAATAACAAGTGTTGTTGAGG - Intergenic
1084896774 11:72277498-72277520 GAAAATAACAAGTGTTGATGAGG - Intergenic
1084993332 11:72950024-72950046 GAAAATAACAAGTGTTGGTGAGG - Intronic
1085138089 11:74112790-74112812 GAAAGTAACAAGTGTTGACGAGG + Intronic
1085234306 11:75001106-75001128 GAAAATGACAAATGTCGGTGGGG - Intronic
1085239258 11:75038667-75038689 GAAAATAACAAGTGTTAGCGAGG - Intergenic
1085552696 11:77389510-77389532 GATAATAACAAGTGTTAGTGAGG - Intronic
1086038246 11:82442661-82442683 GAAAATAACAAGTATTGGTGAGG + Intergenic
1086130037 11:83391787-83391809 GAAAATAACAAGTGTTAGCAAGG - Intergenic
1086182285 11:83967383-83967405 GAGAATAACAAATGTCAGTGAGG - Intronic
1086609720 11:88741158-88741180 GAAAATAACAAATATCAGCGTGG + Intronic
1086684798 11:89719389-89719411 GAAAATACTAAATGTCAGTGAGG - Intergenic
1086996480 11:93362543-93362565 GAAAATAACAAGTGTTGGAGAGG + Intronic
1087451963 11:98335203-98335225 GAAAATAACAAGTTTTGGTGAGG - Intergenic
1087646691 11:100816299-100816321 CAAAAAAACAAGTGTTAGTGAGG - Intronic
1087890683 11:103534449-103534471 GAAGATAACAAGTGTTAGTGAGG + Intergenic
1088474909 11:110225643-110225665 GAAAATAACAATTGTTAGTGAGG + Intronic
1088541115 11:110914877-110914899 AAAGGCAACAAGTGTTAGTGAGG + Intergenic
1088875128 11:113929163-113929185 GAAAATAACAAGTGTTGGTGAGG - Intronic
1089155022 11:116395161-116395183 TACAGTAACAAGTGTTGGTGAGG + Intergenic
1089357621 11:117865207-117865229 GAAAATAACAAGTGTTGGTGAGG + Intronic
1089393767 11:118120463-118120485 GAAAATAGCAAGTGTTAGGGGGG - Intronic
1089535599 11:119158998-119159020 GAAAGTGACAAGTTTGAGGGAGG - Intronic
1089815541 11:121170574-121170596 AAAAGTAACAAATGCTAGTGAGG - Intronic
1090196135 11:124818111-124818133 GAATGTCAGAAGAGTCAGTGGGG - Intergenic
1090219246 11:125002052-125002074 GATAATAACAAGTGTTGGTGAGG - Intronic
1090573291 11:128071278-128071300 GAAAGTAACATGGGTCACCGTGG + Intergenic
1090708120 11:129358316-129358338 GAAAATAGCAAGTGTCAGAGAGG - Intergenic
1091012497 11:132016792-132016814 GACAGTAACAAGTGTTGGTAAGG - Intronic
1091559243 12:1598488-1598510 GAAAATAACAAGTATAGGTGAGG + Intronic
1091621241 12:2090887-2090909 GAAATTAACAAGAGCCAGCGAGG - Intronic
1092334891 12:7623371-7623393 GAAAATTCCAAGTGTCAGTGAGG + Intergenic
1092357070 12:7804905-7804927 AAAAGTAACAATTCTCAGTTTGG + Intergenic
1092379566 12:7984372-7984394 GAAAGTAAGAAGAGACATTGTGG + Intergenic
1092424237 12:8361101-8361123 GAAAATAACAAGTGTTGGTGAGG + Intergenic
1092508756 12:9130444-9130466 GAAAGTAACAAGTGTTGGCAAGG - Intergenic
1092631625 12:10385082-10385104 AAAAATAACAAATGACAGTGAGG + Intronic
1092697782 12:11192661-11192683 AAAAATAACAAATGCCAGTGAGG + Intergenic
1092721024 12:11440678-11440700 GAAAATAACAAGTGTTAGCAAGG + Intronic
1093189151 12:16055355-16055377 AAAAGTAACAAATGCTAGTGAGG + Intergenic
1093517130 12:20001561-20001583 GAAAATAAGAAGTGTTGGTGAGG + Intergenic
1093560797 12:20537038-20537060 GAAAATAACAAGTGTTGTTGAGG - Intronic
1093881827 12:24413305-24413327 GAAAGTTACTAGTGACAGAGAGG - Intergenic
1093889437 12:24501853-24501875 GAAATTATACAGTGTCAGTGAGG - Intergenic
1094761868 12:33542851-33542873 GAAAATAACAAGGGTTGGTGAGG + Intergenic
1094764832 12:33581130-33581152 GAAAATAACAAATGTTGGTGAGG + Intergenic
1095046096 12:37507892-37507914 GAATGTATCAAGTGATAGTGAGG - Intergenic
1095149340 12:38772608-38772630 AAAAGGAAGCAGTGTCAGTGAGG + Intronic
1095723777 12:45429975-45429997 GAAGATAAAAAGTGTCACTGTGG - Exonic
1096132337 12:49169613-49169635 GAAAATAACAAGTCTTAGTAAGG + Intergenic
1096294292 12:50370494-50370516 GAAAATAACAAGTGTGGGTGAGG + Intronic
1096395760 12:51265208-51265230 GAAAGTAACAAGTGTTGGCAAGG + Intronic
1096442299 12:51653815-51653837 GAAAATAACAAGTATGGGTGAGG - Intronic
1096442560 12:51656846-51656868 GAAAGTAACAAGTGTTGGCAAGG + Intronic
1096988401 12:55777984-55778006 AAAAGTAAGAAGTGTGGGTGTGG + Intronic
1097352203 12:58561036-58561058 GAAAATAACAAGAGTTGGTGAGG - Intronic
1097544763 12:60984992-60985014 AAAAATAACAAGTGTTGGTGAGG - Intergenic
1097904227 12:64903764-64903786 GAATGTAAGTAGTGGCAGTGAGG + Intergenic
1098349820 12:69546719-69546741 GAAAGTAACAAATGTTGGTGAGG + Intronic
1098443443 12:70542098-70542120 GACAGTAACAAGAGTTAGTGAGG - Intronic
1098556959 12:71829899-71829921 GAAAATATCAAGTGTTGGTGAGG - Intergenic
1098660767 12:73090739-73090761 TAAAATAACAAGTGTTGGTGAGG + Intergenic
1099189856 12:79551156-79551178 GAAAGAAAGAAGTGTTGGTGAGG + Intergenic
1099734062 12:86543929-86543951 GAAAATAACATGTGGCACTGTGG - Intronic
1100400953 12:94229052-94229074 GAAAATAACAAGTATTGGTGAGG - Intronic
1100413530 12:94347393-94347415 GAAAATAACAAGTGTCAGTAGGG + Intronic
1100459233 12:94782303-94782325 GACAATAACAAGTGTTGGTGAGG - Intergenic
1100573257 12:95862803-95862825 GAAAATAACAAGTGTTGGTGAGG - Intronic
1101414278 12:104495468-104495490 GAAAGTAACAAGTGTTGGCAAGG - Intronic
1101931060 12:109014689-109014711 GAAAATAACAAATGTTGGTGAGG - Intronic
1102138615 12:110596149-110596171 GAAAATAAGAAGTGTTGGTGAGG + Intergenic
1102359957 12:112276927-112276949 GAAAATAACAAATGTTGGTGAGG + Intronic
1102451721 12:113046935-113046957 GAAAATAACAAGTGTTGGTGAGG + Intergenic
1103050504 12:117775305-117775327 AAAACTAACAAGTGTTGGTGAGG - Intronic
1103065704 12:117895576-117895598 GACTGTAACAAGTATCTGTGAGG + Intronic
1103114935 12:118319688-118319710 GAAAACAACAAGTGTTGGTGAGG + Intronic
1103462058 12:121112744-121112766 GAAAATAACAAGTATTGGTGAGG + Intergenic
1103712773 12:122925256-122925278 GAAAATAACAAGTGTTGGTGAGG + Intronic
1103958141 12:124590794-124590816 AAAAATAACAAGTGTTGGTGAGG - Intergenic
1104622123 12:130322876-130322898 AAAAAGAACAAGTGTGAGTGAGG - Intergenic
1105455680 13:20539036-20539058 GAAAGTAGCAAGAGTGAATGGGG - Intergenic
1105490076 13:20880049-20880071 GAAAATAACAAGTGTTGATGAGG + Intronic
1105531299 13:21222967-21222989 GATAATAACAAGTGTTGGTGAGG + Intergenic
1105594545 13:21824628-21824650 GAAAATAACAAGTGTTGGTGAGG - Intergenic
1105732561 13:23232912-23232934 GAAAATACCAAGTGTTAGGGAGG + Intronic
1106182001 13:27377462-27377484 GAAAATAACAAGTGTTGCTGAGG - Intergenic
1106365769 13:29079069-29079091 GACAATAACAAGTGTTGGTGAGG - Intronic
1106370146 13:29124425-29124447 GAAAATAACAAGTGTTGGTGAGG + Intronic
1106649040 13:31669181-31669203 GAAAGTAACAAGTGCTGGTGAGG - Intergenic
1106731739 13:32548392-32548414 GAAAATAACAAGTGTTGGTGAGG + Intergenic
1107008042 13:35637284-35637306 GAAAATAACAAGTGTTAGTGAGG + Intronic
1107082150 13:36386452-36386474 GAAAATAACAAATATTAGTGAGG + Intergenic
1107131508 13:36901323-36901345 AAAAATAACAAGTGTCAGTGAGG - Intronic
1107594387 13:41947553-41947575 AACAATAACAAGTGTTAGTGAGG + Intronic
1107596637 13:41969901-41969923 GAAAATAACAAATGTTGGTGAGG - Intergenic
1107844448 13:44496908-44496930 GAAAATAACAAGTGTTGGTGAGG + Intronic
1107917988 13:45172159-45172181 GACAATAACAAGTGTTGGTGGGG - Intronic
1108231067 13:48341560-48341582 GACAATATCAAGGGTCAGTGAGG - Intronic
1108411443 13:50151670-50151692 GAAAATAACAAGTATTAGTGAGG - Intronic
1108452475 13:50581134-50581156 GAAAATAACAAGTGTTGGTGAGG - Intronic
1108638014 13:52355314-52355336 GAAAACAACAAGTGTTGGTGAGG - Intergenic
1108638222 13:52357241-52357263 GGAAATAACAAGTGTTGGTGAGG + Intergenic
1109029475 13:57174706-57174728 GGATGCAACAAGTGTCAGTAAGG + Intergenic
1109367858 13:61380985-61381007 GAGAATAACAAGTGTTAATGAGG + Intergenic
1109467723 13:62760258-62760280 GAAGATAACAAGTGTTAGAGAGG + Intergenic
1109770640 13:66967398-66967420 GAATGTGACAAGTGTGATTGAGG - Intronic
1109896072 13:68692356-68692378 GATAGTATCAAGTGCTAGTGAGG - Intergenic
1109909836 13:68894456-68894478 AAAAATAACAAGTGTTTGTGAGG - Intergenic
1110241942 13:73277895-73277917 GAAAATAACAAATGTTGGTGAGG + Intergenic
1110284503 13:73733809-73733831 GAAACTAACAGGTGTTAGTGAGG - Intronic
1110780946 13:79464099-79464121 AAAAATAACAAGTGTTAATGGGG - Intergenic
1110840481 13:80136060-80136082 GAAAGTAGCAAGTGTTGATGAGG + Intergenic
1111033531 13:82638959-82638981 GAAAATAACAACTGTCTTTGAGG + Intergenic
1111155972 13:84326653-84326675 GATAGTACCAAGTATCAGTGAGG - Intergenic
1111291677 13:86179205-86179227 GAACGTACCTAGTGTCAGTAAGG + Intergenic
1111380958 13:87451418-87451440 AAAGATAACAAGTGTTAGTGAGG + Intergenic
1111560750 13:89942651-89942673 GAAAATAACAAGTATTGGTGAGG - Intergenic
1111915197 13:94353053-94353075 GACAGTAACGTGTGTCAGGGAGG + Intronic
1111972919 13:94935713-94935735 GAAAATAACAAGTGTGGGTGAGG - Intergenic
1112067151 13:95805287-95805309 GAAAATAAGAAGTGTTGGTGAGG + Intronic
1112489679 13:99850517-99850539 GAAAATAGCAAGTGTTGGTGAGG + Intronic
1112556768 13:100475792-100475814 GACAATAACGAGTGTCAGTGAGG - Intronic
1113090006 13:106607810-106607832 AAAAACAACAAGTGTTAGTGAGG + Intergenic
1113237264 13:108292579-108292601 GAAAATAAGATGTGTCAGTGAGG - Intronic
1113255973 13:108505306-108505328 GAAAATAACAAGTGCTGGTGAGG - Intergenic
1114006857 14:18323108-18323130 GAAAATAACAAGTGTTAGTGAGG + Intergenic
1114279476 14:21178023-21178045 GAAAAGAACAAGTGTTGGTGAGG - Intergenic
1114697124 14:24636444-24636466 TAAAATAACAAGTGTCAGCAAGG - Intergenic
1114707364 14:24740949-24740971 GACACTATCAAGTGTTAGTGTGG + Intergenic
1115429746 14:33302406-33302428 GAAATTAACAAGGGTCAGTATGG + Intronic
1115842008 14:37482785-37482807 AAAGTTAACAAGTGTCAGTGAGG + Intronic
1116136085 14:40926005-40926027 AAAAGTAACAAGTGTTGATGAGG + Intergenic
1116374301 14:44178422-44178444 GATAATAACAAGTGTTGGTGAGG + Intergenic
1116383657 14:44303451-44303473 GAAAATAAAAAATGTCAGTAAGG - Intergenic
1116651441 14:47598166-47598188 GAAAATAACAAATGTTAGTAAGG + Intronic
1116857363 14:49964733-49964755 GAAAACAACAAATGTCGGTGAGG + Intergenic
1116859783 14:49984758-49984780 AAAAATAACAAGTGTGAGTGAGG - Intronic
1117210463 14:53492934-53492956 GAAAATAACAAGTGTCTGTGAGG - Intergenic
1117357220 14:54935913-54935935 GACAATAACAAATGTTAGTGAGG - Intergenic
1117663216 14:58029697-58029719 AAAATTAACAAGTGTTAGTGAGG + Intronic
1117677809 14:58172470-58172492 GAAAATAACAAGTGTTGTTGAGG - Intronic
1118051488 14:62034194-62034216 GATAATAACAAGTGTTGGTGAGG + Intronic
1118250425 14:64154974-64154996 GACAGTAACAAGTGTTAATGTGG + Intronic
1118674792 14:68172158-68172180 GAAGGTAAAAAGTGACACTGAGG - Intronic
1118986759 14:70762387-70762409 GAAAATAACAAGTATTCGTGAGG - Intronic
1119068082 14:71550985-71551007 CAAGGTAAAAAGTGCCAGTGTGG - Intronic
1119339499 14:73864439-73864461 GATAATAACAAGTGTTAGTGAGG - Intronic
1119482721 14:74968900-74968922 AAAATTAGCAAGTGTTAGTGAGG + Intergenic
1119570866 14:75670567-75670589 GAAAATATCAAATGTTAGTGAGG - Intronic
1119828425 14:77678430-77678452 GAAAGTAACTAGTTACTGTGAGG + Intronic
1120563871 14:86030476-86030498 GCAAGTAACAAATGTTGGTGAGG + Intergenic
1120657624 14:87213153-87213175 GAAAATAACAAGTGTTGATGAGG - Intergenic
1120961807 14:90131775-90131797 GAAAATAGCAAATGTCAGTGAGG + Intronic
1120979770 14:90279450-90279472 GAAACCAAGGAGTGTCAGTGAGG + Intronic
1121700534 14:95950724-95950746 GAAAATAACAAGTGTTAGCAAGG - Intergenic
1121766334 14:96489816-96489838 GAAAATAACAAGTGTTGGTGAGG - Intergenic
1121846380 14:97175848-97175870 GAAATTAACAAAGATCAGTGAGG + Intergenic
1122513315 14:102287708-102287730 GATAATAACAAGTGTTGGTGAGG + Intronic
1122567667 14:102672744-102672766 GATAATAACAAGTGTTGGTGAGG + Intronic
1123390785 15:19869759-19869781 GAAAATAACAAGTGTTAGTGAGG + Intergenic
1123801108 15:23821776-23821798 AAAGATAACAAGTGTTAGTGAGG - Intergenic
1123802206 15:23833068-23833090 GAAAATAACGAGTGTTGGTGAGG - Intergenic
1124134688 15:27023949-27023971 GAAAATAACAAGTGCCAGCCTGG - Intronic
1124146393 15:27129684-27129706 GAAACTAACAAGTGTTGGCGAGG - Intronic
1124342303 15:28897651-28897673 GAAAATAGCAGGTGTCGGTGAGG + Intronic
1124351292 15:28957546-28957568 GAAAATAACAAGTGTTGGTGAGG - Intronic
1124427903 15:29578164-29578186 GAAAATAACAAGTGTTGGAGAGG + Intergenic
1124433500 15:29628129-29628151 GAAAATGACAAGTGTTGGTGAGG - Intergenic
1124579066 15:30936349-30936371 GCAAGTAGCAAGTGGAAGTGAGG + Intronic
1124855836 15:33387479-33387501 GAAAATAACAAGTGTTGGTGAGG - Intronic
1125993262 15:44131292-44131314 AAAAATAACAAGTGTTGGTGAGG + Intronic
1126288378 15:47042882-47042904 AAAGATAACAAGTATCAGTGAGG - Intergenic
1126289016 15:47050630-47050652 GAAAGTATCAAGTGATAGTGAGG + Intergenic
1126880598 15:53091923-53091945 GAAAATAACAAATGTTGGTGAGG + Intergenic
1127047974 15:55047729-55047751 GAAAATAACAAATGTTGGTGAGG - Intergenic
1127087262 15:55436187-55436209 GAAAATAACAAGTGTTAGTGAGG - Intronic
1127823236 15:62679115-62679137 GATAATAACAAGTGTTGGTGAGG + Intronic
1128365579 15:66999222-66999244 GATAATAACAAGTGTTGGTGAGG + Intergenic
1128472348 15:67965496-67965518 GAAAATAACAAGTGTTGTTGAGG - Intergenic
1128663400 15:69520205-69520227 GGAAATAACAAGTGTTGGTGAGG + Intergenic
1128696378 15:69766542-69766564 GAAAATAACAAGTGTTGGTGAGG - Intergenic
1128878483 15:71221891-71221913 GAAAATAACAAGTGTTGGTGAGG - Intronic
1129506672 15:76087280-76087302 GAATTTAAGAAGTGGCAGTGGGG + Intronic
1129526523 15:76219822-76219844 GAAAATAACAAGTGTTACTGAGG + Intronic
1130032704 15:80329988-80330010 GAAAATAGCAAGTGTTGGTGTGG + Intergenic
1130431928 15:83856957-83856979 GAAAATAACAAGTATTGGTGAGG - Intronic
1130616045 15:85408974-85408996 GAAAATAACAAGTGTTGGTGAGG - Intronic
1130758616 15:86793943-86793965 GAAAGTAACCAGCGTTGGTGAGG + Intronic
1130768697 15:86901769-86901791 AAAAGTACCAAATTTCAGTGTGG - Intronic
1130772325 15:86937145-86937167 GAAAGTAACAGATGCTAGTGAGG + Intronic
1130943630 15:88533278-88533300 GAAAATGACAAGTTTCATTGAGG + Intronic
1131240553 15:90738806-90738828 GAAAATAACAAGTGTTGCTGAGG + Intronic
1131439779 15:92450860-92450882 GAAAATAACAAGTGTTGGTGAGG + Intronic
1132122358 15:99187834-99187856 GATAGTAAGAAGTGTTGGTGAGG + Intronic
1132158606 15:99515325-99515347 GAAAATAACAAGTGTGAGTGAGG - Intergenic
1132888597 16:2193664-2193686 GAAAGTAACATCTGCCAGTGGGG + Intronic
1132990939 16:2793256-2793278 GAAAATTACAGGTGTCGGTGAGG - Intergenic
1133160173 16:3906246-3906268 GAAAATAACGAGTGTAGGTGAGG + Intergenic
1133374030 16:5268891-5268913 GAAAATAACAAGTGTTGGTTAGG - Intergenic
1133793951 16:9031281-9031303 GAAAATAGCAAGTGTGGGTGAGG - Intergenic
1133928005 16:10209334-10209356 GAAAATAACAAATGTTGGTGAGG - Intergenic
1134415740 16:14042100-14042122 GAAAATAACACGTGTTGGTGAGG - Intergenic
1134559135 16:15192678-15192700 GAAAATAAAAAGGGCCAGTGTGG - Intergenic
1134760977 16:16714887-16714909 GAAAATAACAAGTGTTGGCGAGG - Intergenic
1134774010 16:16836268-16836290 GAAAATAACAAGTGTTGGTGAGG + Intergenic
1134919671 16:18104291-18104313 GAAAATAAAAAGGGCCAGTGTGG - Intergenic
1134985081 16:18644287-18644309 GAAAATAACAAGTGTTGGCGAGG + Intergenic
1135317193 16:21459043-21459065 GAAAATAACAAGTGTTGTTGAGG - Intergenic
1135441698 16:22479837-22479859 GAAAATAACAAGTGTTGTTGAGG + Intronic
1135604935 16:23815683-23815705 GAAAATAACAAATGTTGGTGAGG - Intergenic
1135604940 16:23815718-23815740 GAAAATAACAAATGTTGGTGAGG - Intergenic
1137255883 16:46775037-46775059 GAAAATAACAAGTATTGGTGAGG + Intronic
1137477529 16:48822744-48822766 AAAAATAACAAGTCTTAGTGAGG - Intergenic
1137492552 16:48945031-48945053 GGAAGGAAGAAGTGTCAGTAGGG - Intergenic
1137968098 16:52956710-52956732 GAAAATAACAAGTGTTAGTGAGG + Intergenic
1137981792 16:53075911-53075933 GAAAATAACAAGTGTTGGTGAGG - Intronic
1138059677 16:53877067-53877089 GACAGTGACAAGTGTTGGTGAGG + Intronic
1138213804 16:55185341-55185363 GAAAATAGCAAGTGTTCGTGAGG + Intergenic
1138245916 16:55467182-55467204 CAAAGGAACAAGTGTCCATGAGG + Intronic
1138306642 16:55982747-55982769 GACAATAACAAGTGTTTGTGAGG - Intergenic
1138402132 16:56754977-56754999 GATAGTAACAAGTGTTGGCGAGG + Intronic
1138800321 16:60018644-60018666 AAAAATAACAGATGTCAGTGAGG - Intergenic
1139141507 16:64268443-64268465 GAAATTAGCAAGTGTTAGAGAGG - Intergenic
1139553474 16:67690320-67690342 GAAAATAACAAGGGTTGGTGAGG - Intronic
1139690692 16:68640166-68640188 GAAAGTAACAAGCATTGGTGAGG - Intronic
1139742825 16:69050225-69050247 GACAATAACAAGTGTTCGTGAGG - Intronic
1139802575 16:69535554-69535576 GAAAATAACGAGTGTGATTGAGG - Intergenic
1139912175 16:70404538-70404560 GATAATAACCAGTGTTAGTGAGG + Intronic
1140306360 16:73806663-73806685 CAAAGGACAAAGTGTCAGTGGGG - Intergenic
1140563619 16:76013402-76013424 GAAAATAACTAGTGTTGGTGAGG - Intergenic
1141747051 16:85932886-85932908 GAAAGTACTGAGTGTTAGTGAGG - Intergenic
1142502788 17:342203-342225 AAAAATAACAAGTGTTCGTGAGG + Intronic
1142831867 17:2555094-2555116 TAAAATAACAAGTGTTGGTGAGG - Intergenic
1143071043 17:4293666-4293688 GATAATAACAAATGTCAATGAGG - Intronic
1144254202 17:13449726-13449748 GATAATAACAAGTGTTGGTGAGG + Intergenic
1144398542 17:14870818-14870840 GATATTAACAAGTGTTGGTGAGG + Intergenic
1144695104 17:17298687-17298709 GAAAATAACAAGCATTAGTGAGG - Intergenic
1145199234 17:20926221-20926243 GAAAATAACAAATGTCAAGGAGG - Intergenic
1145235631 17:21206203-21206225 GAAAATAACAAGTGTTGGTGAGG - Intronic
1146815781 17:35941145-35941167 GATAATAACAAGTGTTGGTGAGG - Intronic
1147117549 17:38312951-38312973 GAAAGTAATAGGTATCAGTGAGG - Intronic
1147247000 17:39128540-39128562 GAAAATAACAAGTGTTGGCGAGG + Intronic
1147860496 17:43519248-43519270 GAAACTAACAAATGTCAGTGAGG - Intronic
1148034890 17:44652683-44652705 GAAAATAACAAGTGTTGGTGAGG + Intergenic
1148294266 17:46486640-46486662 GAAAATAAGAAGTGTTGGTGAGG - Intergenic
1148316449 17:46704354-46704376 GAAAATAAGAAGTGTTGGTGAGG - Intronic
1148412138 17:47476639-47476661 GAAAGTAATAGGTATCAGTGAGG + Intergenic
1148829661 17:50423249-50423271 GAAAATAACAAGTATTGGTGGGG - Intergenic
1149672602 17:58428733-58428755 GAAAATACCAAGTGTTAGCGAGG + Intronic
1149816469 17:59729648-59729670 AATAATAACAAGTGTTAGTGAGG - Intronic
1150112613 17:62515468-62515490 CAAAATAACAAGTATTAGTGAGG - Intronic
1150195827 17:63298046-63298068 AAAACTAACAAGTGTTAATGAGG + Intronic
1150589085 17:66545908-66545930 AAAATTAACAAGTCTCAGTAAGG - Intronic
1150733137 17:67713065-67713087 TAAAATAACAATTGTTAGTGAGG + Intergenic
1150889947 17:69136233-69136255 CACAGGAACAAGTGTCATTGGGG - Exonic
1150921130 17:69484419-69484441 GAAAATAACAAGTGTAGGTGAGG + Intronic
1151861346 17:76764916-76764938 AAAGGTAACAAGTGTTGGTGAGG - Intronic
1152153854 17:78620144-78620166 GAAAATAACAAGAGTTGGTGAGG + Intergenic
1152192159 17:78895469-78895491 GACAATAGCAACTGTCAGTGAGG + Intronic
1152345769 17:79750308-79750330 GAAAATAACAAGTGTTGGTAAGG + Intergenic
1152384566 17:79963728-79963750 AAAACTAACAAGTGTCGGTGAGG - Intronic
1152917200 17:83046570-83046592 GAAAATAACAAGTGTTGATGAGG + Intronic
1203165710 17_GL000205v2_random:91743-91765 GAAAATCACAAGTGTTGGTGAGG - Intergenic
1153101872 18:1480908-1480930 GAAAATAACAAATGCTAGTGAGG + Intergenic
1153132137 18:1866281-1866303 GAAAATAACAAGTGTTAGCAAGG + Intergenic
1153374645 18:4362075-4362097 TAAAATAACAAGTGTTGGTGAGG + Intronic
1153450688 18:5224828-5224850 GAAAATAACAAGTGTTGGGGAGG + Intergenic
1153460777 18:5330752-5330774 GACAATAACAAGTGTTATTGAGG + Intergenic
1153579257 18:6555400-6555422 GAAAATAACAAGTGTTGGTGAGG - Intronic
1153631471 18:7074214-7074236 GAAAATAATAAGTGTTGGTGAGG - Intronic
1153883387 18:9439955-9439977 GAAAATAACAAGTGTTGGTGAGG + Intergenic
1154065579 18:11104254-11104276 GAATGTAAAAGGTGGCAGTGTGG + Intronic
1154291505 18:13111967-13111989 GAAAATAACAGGTGTTGGTGAGG + Intronic
1154301494 18:13196782-13196804 GAAAATAACAAGTGTTACTGAGG - Intergenic
1154530609 18:15340898-15340920 GAAAATAACAAGGGTTAGTGAGG - Intergenic
1155025586 18:21937627-21937649 GAAAATAACAGGTGTTGGTGAGG + Intergenic
1155871496 18:31034374-31034396 GAAAATAACAAGTATTGGTGAGG + Intronic
1156323423 18:36049963-36049985 GAAAATAACAAATGTTAGTGAGG - Intronic
1156621229 18:38854419-38854441 GAAGGTATTGAGTGTCAGTGTGG - Intergenic
1156807606 18:41204864-41204886 GAAGGTTACAAATGTGAGTGTGG - Intergenic
1157397974 18:47359240-47359262 AAAAGTAACAAGTGTTGGTGAGG - Intergenic
1157427810 18:47599166-47599188 AAAAGTAACAAGTGAAAGTGTGG - Intergenic
1157555067 18:48608101-48608123 GCAGGTAACATGTGTGAGTGAGG + Intronic
1157656361 18:49393172-49393194 GAAAGTAACAAGTGTTAGCAAGG + Intronic
1157708617 18:49831601-49831623 GAAAATCACAAGTGTTGGTGAGG + Intronic
1158194004 18:54864159-54864181 GACAGTAACAAGTGTTGGTGAGG - Intronic
1158382911 18:56954745-56954767 AATAGTAAAAAGTGTCATTGGGG + Intronic
1158660154 18:59379822-59379844 GAAAATAACAAGTGTTGGTGAGG + Intergenic
1158845343 18:61436404-61436426 GATAATAACAAGTGTTGGTGAGG - Intronic
1158951902 18:62502793-62502815 GAAAGTAACAAGTATTGGCGAGG + Intergenic
1158962734 18:62600041-62600063 GAAAATAACAAGTGTTGGTGAGG - Intergenic
1159171058 18:64767428-64767450 GAAAGGAACAAGAGACATTGAGG - Intergenic
1159416560 18:68156899-68156921 AAAAGTAACAAATGCTAGTGAGG - Intergenic
1159661612 18:71103404-71103426 CAGAGTAACAAGTGTTAGTGAGG - Intergenic
1159772266 18:72559916-72559938 AAAATTAACAAGTGTCACCGAGG - Intronic
1159940690 18:74405343-74405365 GAAAATAACAAGTATTGGTGAGG - Intergenic
1160435700 18:78850908-78850930 GAAGGTAGCAAGTGTTGGTGAGG + Intergenic
1160470089 18:79124002-79124024 GACAGTAACAAGTGTTGGTGAGG + Intronic
1161903313 19:7136074-7136096 GACAATAACAAGTGTCGGTGAGG - Intronic
1162465913 19:10840291-10840313 CAAAGTAACAAGTGTTGGTGAGG - Intronic
1162707692 19:12567725-12567747 GAAAATAACAAGTGCTGGTGAGG - Intronic
1163197187 19:15730685-15730707 GACAGTAACAAGTATTGGTGAGG - Intergenic
1163308636 19:16498596-16498618 ACACGTAACAAGTGTCAGTGAGG - Intronic
1163684838 19:18705721-18705743 GAAAATAACAAGTGTTATTGAGG - Intronic
1164428136 19:28162289-28162311 GAAAGTAACAAGTGTTAACAAGG - Intergenic
1164577814 19:29416334-29416356 GAGATTGACAAGTGTCAGAGAGG - Intergenic
1164791156 19:30982586-30982608 GACAATACCAAGTGTTAGTGAGG - Intergenic
1164926500 19:32134016-32134038 GAAAATAACACGTGTCAGTGGGG + Intergenic
1164968174 19:32505530-32505552 GAAAATAACAAGTGTTGGTGAGG + Intergenic
1165122779 19:33572544-33572566 GAAAATAACAAGTGTTGATGAGG + Intergenic
1165709503 19:37999948-37999970 CAAGGTCACAAGTGTTAGTGGGG - Intronic
1167124755 19:47541752-47541774 GACAATAACAAGTGTTAGTGAGG + Intronic
1167407548 19:49323703-49323725 GAAAATAAGAAGTGTTGGTGAGG + Intronic
1167434366 19:49470521-49470543 GAAAGTCCCAGGTGTCTGTGGGG - Exonic
1167537406 19:50063356-50063378 GATAGTAACAAGCGTTGGTGAGG + Intergenic
1167724980 19:51205232-51205254 GAACATAACACGTGTCGGTGAGG + Intergenic
1167767605 19:51494454-51494476 AAAAGTAACAAGCGTTGGTGAGG + Intronic
1168591207 19:57635882-57635904 GAAAATAACAAGTGATGGTGAGG - Intronic
1168716463 19:58531137-58531159 GAAAATGACAAGTGAGAGTGAGG - Intronic
925214270 2:2080693-2080715 GAAAGGAACAAATGTTGGTGAGG + Intronic
926117126 2:10220413-10220435 GAAAATAACAAGTGTTCGTGGGG + Intergenic
926496947 2:13601533-13601555 AAAAATAACAAGTGCTAGTGAGG + Intergenic
926657541 2:15425175-15425197 CAAAGTAACAAGTATCAGATGGG + Intronic
926764205 2:16308728-16308750 GAAATTAACAAGTGTTGGTAAGG - Intergenic
927473982 2:23397951-23397973 GAAAATAACAAGTGTTGGTGAGG + Intronic
927580112 2:24235852-24235874 GATAATAACAAGTGCCGGTGAGG + Intronic
927799665 2:26086449-26086471 GAAAGTAACAAGTATGATTGAGG + Intronic
928140039 2:28720524-28720546 GATAATAACAAGTGTTGGTGAGG + Intergenic
928344441 2:30478044-30478066 TAAAGTCAAAAGTGTTAGTGAGG + Intronic
928386145 2:30870007-30870029 AAAAATAACAAGTGTCGGTGAGG - Intergenic
928814052 2:35268058-35268080 AAATGTACCAAGTGTTAGTGAGG - Intergenic
929661746 2:43793149-43793171 GAAGATAACAAGTATTAGTGAGG - Intronic
929711233 2:44268900-44268922 GAAAATAACAAGTGTTGATGAGG + Intergenic
929939412 2:46321518-46321540 GAAAATAACAAGTGTTAGCAGGG - Intronic
930188198 2:48431016-48431038 GAAAGTAACAAGTATTAGTAAGG + Intergenic
930496579 2:52152631-52152653 GAAAATAACAAATGTTGGTGAGG + Intergenic
930675965 2:54200904-54200926 CAAAATAACAAGTGTTGGTGAGG - Intronic
930729743 2:54716666-54716688 GACAGTAACAAGTGTTGGAGAGG - Intergenic
931409500 2:62015669-62015691 GAAACTAACAAGTGTTAGTGAGG - Intronic
931426067 2:62172555-62172577 GATAATAACAAGTGTTATTGAGG - Intergenic
931506334 2:62931378-62931400 GAAAATAACAAGTATTGGTGAGG + Intronic
931519091 2:63075409-63075431 GAAAAAAACAAGTGTCAGCAAGG - Intergenic
931596026 2:63944457-63944479 GAAAATCACAAGTGACAGTGTGG - Intronic
931857778 2:66321811-66321833 GAAAATAACAAGTGTTGGTGAGG + Intergenic
932176853 2:69610863-69610885 GAAAATAACAAGTTTTGGTGAGG + Intronic
932558349 2:72845301-72845323 GAAAATAACAAGTGTTGGTGTGG + Intergenic
932661277 2:73654949-73654971 GAAAATAACAAGTATTGGTGAGG - Intergenic
933681369 2:85104420-85104442 GATAGTAACAAGTGTTACTGAGG + Intergenic
933822218 2:86123470-86123492 CAAAGCAACAAGTGACAGCGTGG - Intronic
933828653 2:86188022-86188044 GAAAATAACAAATGTTGGTGAGG - Intronic
934639152 2:96016337-96016359 AAAAGTAACCAGTGTTAGTAAGG - Intergenic
934651770 2:96096316-96096338 GAAAATAACAAGTATTGGTGAGG + Intergenic
934794493 2:97089074-97089096 AAAAGTAACCAGTGTTAGTAAGG + Intronic
935009858 2:99124124-99124146 GAAAATAACAAGTGTTGGTGAGG - Intronic
935032961 2:99339677-99339699 GAAAGTAAAAAGTGTAAGTAGGG - Intronic
935263247 2:101372982-101373004 GACAATAACAAGTGTTGGTGAGG + Intronic
935275977 2:101475451-101475473 GAAACTAACGAGTGTTGGTGAGG + Intergenic
935823881 2:106922282-106922304 GAAAATGACAAGTGTTGGTGGGG - Intergenic
936797318 2:116223476-116223498 GAAATTAACAAGCATTAGTGAGG + Intergenic
936868244 2:117102524-117102546 GAAAGTAACAACAGACACTGGGG - Intergenic
937224800 2:120362323-120362345 GACAGTAACAACTGTTGGTGAGG + Intergenic
937274892 2:120677806-120677828 GTAATTAACAAGTATCTGTGAGG - Intergenic
937376895 2:121343234-121343256 GAAAATAACAAGTGTTGGTGAGG + Intronic
937605387 2:123794452-123794474 GAAAATAACAAGTGTTAGTGAGG - Intergenic
938147133 2:128844894-128844916 GAAAATAACAAGTGTCGGTGAGG - Intergenic
938184913 2:129222611-129222633 CAAAATAACAAATGTTAGTGAGG + Intergenic
938529709 2:132172370-132172392 GAAAATAACAAGTGTTAGTGAGG - Intronic
938898313 2:135775138-135775160 GAAAGTAATAAGTGTTTGTGAGG + Intronic
939143450 2:138382850-138382872 AAAAATAACAAGTGTTGGTGAGG + Intergenic
939369020 2:141274055-141274077 GACAATAACAAGTGTTGGTGAGG + Intronic
939515493 2:143162345-143162367 AAAAGTGAGAAGTGACAGTGGGG + Intronic
939544330 2:143534211-143534233 GGAAGAAAGAAGTGCCAGTGAGG - Intronic
939974688 2:148703898-148703920 GAAAATAACAAGTGTTAGCAAGG + Intronic
940191446 2:151044822-151044844 GACAATAACAAGTGTTGGTGAGG - Intronic
940228459 2:151425056-151425078 GAAAATAAAAAGTGTTGGTGAGG - Intronic
940295108 2:152114501-152114523 GAAATTAACAAATGACAGTGAGG + Intergenic
940554539 2:155206635-155206657 GAAAGTAACAAGTGTTGATGAGG + Intergenic
940803931 2:158163958-158163980 GAAAATAACAAGTGCCAGCAAGG + Intergenic
941115594 2:161468340-161468362 GAAAATAACAAGTGTTTGTGAGG - Intronic
941256099 2:163232792-163232814 GAAAATAACAAATGTCAGTGAGG - Intergenic
941338725 2:164278519-164278541 AAAGGAAACAAGTGTCAGTGAGG - Intergenic
941369669 2:164648670-164648692 GAAAATAACAAGTGTTGGTGAGG - Intergenic
942089621 2:172477009-172477031 GAAGTTAACAACTGTCTGTGAGG + Intronic
942118352 2:172750634-172750656 TAAAATAACAAGTGTCATTGAGG - Intronic
942282808 2:174383868-174383890 GAAAATAACAAATGTTAGAGAGG + Intronic
942762942 2:179421342-179421364 GAAAATAACAAGTGTTGGTGAGG - Intergenic
943171822 2:184411410-184411432 GAAAATGACAAATGTTAGTGAGG + Intergenic
943328245 2:186527315-186527337 GAAAATAACAAGTGTTGGGGAGG - Intergenic
943901677 2:193446699-193446721 AAAAGTAACTGATGTCAGTGAGG - Intergenic
944043435 2:195381501-195381523 AAAGATAACAAGTGTCAGTGAGG + Intergenic
944258551 2:197650939-197650961 CAAAGAAACAAGTGTTAGTGAGG - Intronic
944303379 2:198151101-198151123 GATAATAACAAGTGTTAGTGAGG + Intronic
944560584 2:200932976-200932998 GAAAGAAACACCTGTCAGTGAGG - Intronic
944681500 2:202081503-202081525 GAAAGTAACAAGTGTTGATGAGG - Intronic
945694371 2:213084084-213084106 GCAGGTGACAAGTGTCAGTTTGG - Intronic
945764577 2:213959209-213959231 GAATGTAATATGTCTCAGTGTGG + Intronic
945900497 2:215532597-215532619 AAAAATAACAAGTGTTGGTGAGG + Intergenic
946851449 2:223910758-223910780 GAAAATAACAAGTGTTAGCAAGG + Intronic
947339602 2:229123671-229123693 GATAATAACAAGTGTTGGTGAGG - Intronic
947457693 2:230270560-230270582 GAAAATAACAAGTGGTGGTGAGG - Intronic
947468033 2:230371572-230371594 GAAAATAACAAGTGGTAGTGAGG - Intronic
947544082 2:230998719-230998741 GACAATAACAAGTGTTGGTGAGG + Intronic
947663541 2:231888255-231888277 GAAAATAACAAGTGTTGGTGAGG + Intergenic
948677427 2:239606608-239606630 GAAAGTAACCAGTGTTGGTGAGG + Intergenic
1168783145 20:512030-512052 GAAAATAACAAGTGTTAGTAAGG - Intronic
1168858969 20:1031245-1031267 GAAAATACAAAGTGTCGGTGAGG + Intergenic
1168983210 20:2025453-2025475 GTAAGGAAAAAGTGTGAGTGAGG - Intergenic
1169170761 20:3463073-3463095 GACAATAACAAGTGTTGGTGAGG - Intergenic
1169238682 20:3955009-3955031 AAAAATAACAAGTGTTAATGAGG - Intronic
1170129441 20:13002800-13002822 GACTATACCAAGTGTCAGTGAGG + Intergenic
1170175432 20:13463851-13463873 GAAAATAACAAGTATTGGTGAGG + Intronic
1170482609 20:16781992-16782014 AAAAATAACATATGTCAGTGAGG - Intergenic
1170593519 20:17788702-17788724 GAAAATAACAAGTGTTAGCAAGG - Intergenic
1170754126 20:19183169-19183191 GACAATAACAAGTGTTGGTGAGG - Intergenic
1171348006 20:24480466-24480488 GAAAATAACAAGTGTTGGTAAGG + Intronic
1171355169 20:24538749-24538771 GAAAATAACAAGTGTTGGTGAGG - Intronic
1171445497 20:25200122-25200144 GAAAATAACAAGTATTAGTGAGG - Intronic
1171540653 20:25951493-25951515 GAAAGTATCAAGCGATAGTGAGG - Intergenic
1171783970 20:29446784-29446806 GAAAATCACAAGTGTTGGTGAGG - Intergenic
1171800418 20:29608845-29608867 GAAAGCATCAAGTGATAGTGAGG + Intergenic
1171843682 20:30247863-30247885 GAAAGTATCAAGTGATAGTGAGG - Intergenic
1172747059 20:37219168-37219190 GATAATAACAAGTGTTGGTGAGG - Intronic
1172974754 20:38897742-38897764 GAAAATAGCAAGTGTTGGTGAGG - Intronic
1173719593 20:45243303-45243325 TAAAATAACAAGTGTTAGTGAGG - Intergenic
1173850518 20:46215034-46215056 GACAGTACCAGGAGTCAGTGAGG + Intronic
1174055834 20:47797669-47797691 GAAAATCACAAGTGTTGGTGAGG + Intergenic
1174109565 20:48189199-48189221 GACAATAACAAGTGTTGGTGAGG - Intergenic
1174211530 20:48882731-48882753 GATAATAACAAGTGTCAGTGAGG - Intergenic
1174708444 20:52680756-52680778 GAGATTAACAAGTGATAGTGTGG - Intergenic
1175254629 20:57633130-57633152 GAAAGTAACAAATATTGGTGAGG + Intergenic
1175465498 20:59188294-59188316 TAAAATAACAAGTGTTGGTGAGG - Intergenic
1175477027 20:59283555-59283577 GAAAGTAACCAGTGTTGGTGAGG - Intergenic
1175614569 20:60384851-60384873 GAAAATAACAAGTGTTACTGAGG + Intergenic
1176043003 20:63075581-63075603 GAAAATAACAAATGTTGGTGAGG - Intergenic
1176049377 20:63108613-63108635 GAAAATAACACGTGTTGGTGAGG - Intergenic
1176335831 21:5598784-5598806 GAAAATCACAAGTGTTGGTGAGG + Intergenic
1176391926 21:6222164-6222186 GAAAATCACAAGTGTTGGTGAGG - Intergenic
1176406043 21:6367336-6367358 GAAAATCACAAGTGTTGGTGAGG + Intergenic
1176469493 21:7094010-7094032 GAAAATCACAAGTGTTGGTGAGG + Intergenic
1176493054 21:7475788-7475810 GAAAATCACAAGTGTTGGTGAGG + Intergenic
1176507588 21:7662595-7662617 GAAAATCACAAGTGTTGGTGAGG - Intergenic
1176766801 21:13027554-13027576 GAAAATAACAAGGGTTAGTGAGG + Intergenic
1176881056 21:14194146-14194168 GAAAATAACAACTGTTGGTGAGG + Intronic
1177002403 21:15630596-15630618 GAAAGTAACAAGTGTTTTTAAGG + Intergenic
1177286093 21:19052371-19052393 AGAAATAACAAATGTCAGTGAGG - Intergenic
1177620681 21:23588577-23588599 GACAATAACAAGTGTTGGTGAGG - Intergenic
1178095511 21:29211089-29211111 GAAAATCACAAGTGTTGGTGAGG + Intronic
1178395924 21:32243549-32243571 GACAGTAACAAGTGCCGGTGAGG + Intergenic
1178501837 21:33132011-33132033 GAAAATGACAAGTGTTGGTGAGG + Intergenic
1179191831 21:39129250-39129272 GAAAATAACAAGTGTTGGTGAGG - Intergenic
1179234351 21:39531692-39531714 GAAAATAACAAGTGTTAGTGAGG + Intergenic
1179269018 21:39834456-39834478 GAAATTAACAAGTATTGGTGAGG - Intergenic
1179386925 21:40952103-40952125 GACAGTAACAAGTGTTGGTGGGG - Intergenic
1179420479 21:41232327-41232349 GAAAGGAGCAAGTGTGTGTGGGG - Intronic
1179496204 21:41772704-41772726 GAAAGCAAGGAGGGTCAGTGTGG - Intergenic
1179665717 21:42910938-42910960 GAAAGTAACCAATGTAGGTGAGG + Intronic
1179788968 21:43744618-43744640 GAAAATAGCAAGTGTGAGCGAGG + Intronic
1179962923 21:44780874-44780896 GAAAGTAAAAAGTGTTAGAAAGG - Intronic
1180431364 22:15253918-15253940 GAAAATAACAAGTGTTAGTGAGG + Intergenic
1180513926 22:16121841-16121863 GAAAATAACAAGTGTTAGTGAGG + Intergenic
1180919221 22:19511147-19511169 GACAATAACAAGTGTCGGTGAGG - Intronic
1180994437 22:19958550-19958572 GAAAATAACAAGTGTTAGCAAGG - Intronic
1181158701 22:20943028-20943050 GAAAATAACAAGTGTTGATGAGG - Intronic
1181579484 22:23819804-23819826 AAAACTAACAAGTGTGAGTGAGG - Intronic
1181969658 22:26680619-26680641 GAATGAAACAAGAGTCAGTTGGG + Intergenic
1182002329 22:26930094-26930116 GAAAGTAACAAGTGTGGGAAAGG - Intergenic
1182247420 22:28970358-28970380 GATACTAAAAAGTGTCAGTGAGG + Intronic
1182955943 22:34426569-34426591 GAAGGGAACAACTGTCACTGGGG + Intergenic
1184258365 22:43300269-43300291 GAAAGGAACAAGTGTTGGCGAGG - Intronic
1184597633 22:45523931-45523953 GAAAATCACAAGTGTTGGTGAGG - Intronic
1184957221 22:47897566-47897588 GGAAGTACCAAGTGTTGGTGAGG + Intergenic
949380556 3:3440778-3440800 TAAAGTAACAAGTGTTAGTGAGG + Intergenic
949528118 3:4926515-4926537 CAAAATAACAAGTGTTGGTGAGG + Intergenic
949907557 3:8871382-8871404 GAAAATAACAAGTGTTGGTGAGG + Intronic
949956433 3:9272901-9272923 CAAAATAATAAGTGTTAGTGAGG - Intronic
950271753 3:11621813-11621835 GACAATAACAAGTGTTGGTGAGG - Intronic
950321984 3:12064720-12064742 GAGAATAACAAGTGTTGGTGAGG + Intronic
950574267 3:13822073-13822095 GACAATAACAAGTGTCGGCGAGG + Intronic
950615424 3:14154131-14154153 GAAAGTAACAAGTGTCAGTGAGG + Intronic
950669340 3:14516652-14516674 GAAATTAACAAATGGCAGAGAGG + Intronic
950752370 3:15140098-15140120 GAAAATAACAAGTGTTGGTGAGG - Intergenic
951186684 3:19721908-19721930 TAAAGTAATGAGTGGCAGTGAGG + Intergenic
951377011 3:21931287-21931309 GACAGTAACAAGTATTAGAGAGG + Intronic
951737163 3:25880166-25880188 GAAAATAACAAGTGTTGATGAGG - Intergenic
951748224 3:26003448-26003470 GACAATAACAAGTGTTGGTGAGG + Intergenic
951758236 3:26116629-26116651 CAAAATAACAAGTGTTAGTGAGG - Intergenic
951800782 3:26593725-26593747 AAAAATAACAAGTGTCGGTGAGG - Intergenic
952021439 3:29026004-29026026 TAAAATAACAAATGTTAGTGAGG + Intergenic
952706931 3:36387983-36388005 GAAAATAACAAGTATTGGTGAGG - Intronic
952914064 3:38218300-38218322 GAAACTAACAAGCGTTGGTGAGG - Intronic
952947321 3:38487054-38487076 GAAAGTGACACCTGGCAGTGAGG + Exonic
953437638 3:42891506-42891528 GAAAATAACAAGTGATAGTGAGG + Intronic
953592789 3:44275848-44275870 GAAAATAACAAATGTTGGTGAGG - Intronic
953836118 3:46345925-46345947 GAAAATAACAAGTGTTGTTGAGG - Intergenic
953857682 3:46513080-46513102 GAAAATAACAAGTGTTTGTGAGG - Intergenic
954302886 3:49709980-49710002 GAAAATAAGAAGTGTCGGTAAGG - Intronic
954347951 3:50016596-50016618 AACGGTAACAAGTGTTAGTGAGG - Intronic
954585880 3:51736105-51736127 GCAAATAACAAGTGTCAGCGAGG - Intergenic
954591092 3:51782674-51782696 GAAAGTAATAAGTGTTGGTGAGG - Intergenic
954804914 3:53212607-53212629 GAAAGTAACAAGTGTTAGCGAGG - Intergenic
954880395 3:53831973-53831995 AAAAGTAACAAGTGTTAATGAGG + Intronic
955668910 3:61381429-61381451 GAAAGTAAAGATTCTCAGTGTGG - Intergenic
956169328 3:66420306-66420328 GAAAATAACAAGTGTGGGTGAGG + Intronic
956253378 3:67257947-67257969 AAAAGTCAGAAGTGTTAGTGAGG + Intergenic
956432202 3:69198428-69198450 AAAAATAACAAGTGTCGGTGAGG + Intronic
956608292 3:71095514-71095536 GAAAGAAAAAACTGCCAGTGTGG - Intronic
957068241 3:75544193-75544215 GAAAATAACAAGTGTTGGTGAGG + Intergenic
957778160 3:84782924-84782946 GAAAGTAATAAATGTTGGTGAGG + Intergenic
957807917 3:85175139-85175161 GAAAATAACAAGTGTATGTAAGG + Intronic
958504438 3:94956231-94956253 GGAAGCAGCAAGTGTCAGCGAGG - Intergenic
958504941 3:94964300-94964322 AAAGATAACAAGTGTCAGTGAGG - Intergenic
958862660 3:99464032-99464054 GAAAATAACAAGTGTTAGCAAGG + Intergenic
959042428 3:101437942-101437964 GAAAGTAACAAGTGTTGATGTGG + Intronic
959195585 3:103176430-103176452 GAAAATAAGAAGTGTCGTTGAGG - Intergenic
959844451 3:111017345-111017367 CAAAGTATCAAGTGTGAGGGTGG - Intergenic
960678283 3:120219283-120219305 AAAATTAACAAGTGTTTGTGAGG - Intronic
960779131 3:121298128-121298150 GAAAATAACAAGTGTTGATGAGG - Intronic
960804872 3:121574011-121574033 GAAAAGAACAAGTGTCGGTGAGG + Intronic
960860664 3:122149423-122149445 CAAAGAAACAGGTGGCAGTGTGG + Intergenic
960880891 3:122343803-122343825 GATAATAACAAGTGTGGGTGAGG - Intergenic
960920493 3:122742406-122742428 GATATTAACAAGTGTTGGTGAGG + Intronic
961129237 3:124450195-124450217 CACAGTAACAAGTGTTGGTGAGG - Intronic
961221460 3:125204077-125204099 TAAAATAACAAGTGTTTGTGGGG + Intronic
961396710 3:126598413-126598435 GAAAATAGCAAGTGTTGGTGAGG + Intronic
961401547 3:126649336-126649358 GAAAATAACAAATGTTGGTGAGG + Intronic
961504994 3:127364190-127364212 GAAAATAACAAGTGTTTCTGAGG - Intergenic
961963331 3:130875768-130875790 AAAACTAACAAATGCCAGTGAGG - Intronic
963158914 3:142129932-142129954 GAAAATAACAAGTGTTAGCAAGG + Intronic
963166185 3:142206410-142206432 GAAGATAACAAGTGTTGGTGAGG - Intronic
963491837 3:146011454-146011476 GAAAATAAAAAGTGCTAGTGAGG - Intergenic
963840523 3:150100437-150100459 GAAAATAACAAGTGTTGGTGAGG - Intergenic
963960232 3:151301743-151301765 GACAGTAACAAGTGTTGCTGAGG + Intronic
964005469 3:151822174-151822196 GATAATAACAAGCGTTAGTGGGG + Intronic
964800917 3:160556367-160556389 GAAAATAACAGGTGTTGGTGAGG - Intronic
964886270 3:161486677-161486699 GAATGTTACAAGTGACAGTCAGG - Intergenic
965113454 3:164457177-164457199 GAAAGTAGCAAATGTCAGCAAGG - Intergenic
965218490 3:165896117-165896139 GTAAGTAAGAAATGTCAGAGGGG + Intergenic
965789820 3:172375358-172375380 GAAAGCATCAAGTGTCAATTGGG - Intronic
965949947 3:174296850-174296872 GAAAGTATGAAATGGCAGTGGGG - Intergenic
966007341 3:175031766-175031788 AAAAATAACAGATGTCAGTGAGG - Intronic
966294064 3:178397390-178397412 GAAAATACCAACTGTTAGTGAGG - Intergenic
966520294 3:180867442-180867464 GACAATAACAAGTGTTGGTGAGG + Intronic
966534989 3:181022182-181022204 GAAAATAACAAGTGTTGGTGAGG - Intergenic
967132225 3:186482252-186482274 GAAATTAACAGATGCCAGTGAGG + Intergenic
967165461 3:186775915-186775937 GAAAATAACAATTGTTGGTGTGG - Intergenic
967756189 3:193172146-193172168 GAAAATAACAAGTGTTGGTAAGG + Intergenic
968018754 3:195364619-195364641 GCAATTAACAAATGTTAGTGAGG + Intronic
968022945 3:195411123-195411145 AAACATAACAAGTGTCAATGAGG + Intronic
968169828 3:196501069-196501091 GAAAATAACAAGTGTTGGTGAGG + Intronic
968243575 3:197117179-197117201 AAAAGTAACAAGTGTTGATGAGG + Intronic
968246768 3:197158262-197158284 GAAAATAAAAAGTGTTGGTGAGG + Intronic
968324654 3:197802887-197802909 TAAAGTAACTGGTTTCAGTGGGG + Intronic
968604485 4:1526066-1526088 GAATGTAATAAGTGTTGGTGAGG - Intergenic
968792419 4:2676270-2676292 GAAAATAACAAGTGTTAATGAGG - Intronic
969012591 4:4078768-4078790 GAAAATAACAAGTGTTGGTGAGG + Intergenic
969352827 4:6607880-6607902 GAAAATAACAAGTGTGGGCGAGG - Intronic
969741270 4:9029003-9029025 GAAAATAACAAGTGGTGGTGAGG - Intergenic
969800618 4:9561893-9561915 TAAAATAACAAGTGTTGGTGAGG - Intergenic
969862017 4:10044406-10044428 GAAAATAATAAGTGTCAGCAAGG + Intronic
970497182 4:16638244-16638266 GGAAGTACCAAGTGAAAGTGTGG - Intronic
971166440 4:24188638-24188660 GAAAATAACAAGTGTTGGAGAGG + Intergenic
971374018 4:26041686-26041708 GAAAGAAACAAATGTGGGTGGGG + Intergenic
971491750 4:27219722-27219744 GAAAATATCAAGTATCTGTGAGG - Intergenic
971722810 4:30268303-30268325 GAAAATAACAAGTTTTGGTGAGG + Intergenic
971816239 4:31493623-31493645 AAAAATAACAAGTGTTAGTGAGG + Intergenic
972549021 4:40110392-40110414 GACAATAACAAGTGTTGGTGAGG - Intronic
972760688 4:42100667-42100689 AAAAATAACAAGTGTTCGTGAGG - Intergenic
973000172 4:44937976-44937998 GAAAGTAACAAGTCTCACTAAGG - Intergenic
973224731 4:47770366-47770388 GAAAATAACAAGTGCTGGTGAGG + Intronic
973830097 4:54750554-54750576 AAAAATAACAGATGTCAGTGAGG + Intergenic
973967070 4:56173872-56173894 GAAAATAACAAGTGTTGGTGAGG - Intronic
974011404 4:56610930-56610952 GAAAATAACAAATGTTTGTGTGG + Intergenic
975559880 4:75699049-75699071 GAAAGTAACAAGTGGGACAGAGG - Intronic
975615964 4:76247585-76247607 GAAAATAACAAGTGTTGGTGAGG - Intronic
976166453 4:82260529-82260551 GATAATAACAAGTATCACTGAGG - Intergenic
976374649 4:84330868-84330890 GATAATAACAAGTGTTGGTGAGG - Intergenic
976384856 4:84444994-84445016 GAAAATAACAAGTGTTGGTGAGG - Intergenic
976456513 4:85253781-85253803 GAAAATAACAAGAGTTGGTGAGG - Intergenic
976831019 4:89313959-89313981 GAAAATAGCAAGTGCTAGTGAGG + Intergenic
977155197 4:93563344-93563366 GAAAGAAACATGTTTAAGTGAGG - Intronic
977193310 4:94027526-94027548 GACAATAGCAAGTGTTAGTGAGG + Intergenic
977278674 4:95011260-95011282 GAAAGAAACAACAGACAGTGGGG - Intronic
977433391 4:96961332-96961354 GATTATACCAAGTGTCAGTGAGG - Intergenic
977449190 4:97173160-97173182 GAAAATAACAAATGTCATTTTGG + Intergenic
977629498 4:99225964-99225986 AAAGATAACAAGTGTTAGTGAGG - Intergenic
978677385 4:111335684-111335706 GATGATAACAAGTGTTAGTGAGG + Intergenic
978870376 4:113568722-113568744 GAAAGTAACAAGTGTTGGCCAGG - Intronic
979317554 4:119282464-119282486 GAAAATAACAAGTGCTAGTGAGG - Intronic
979366245 4:119827807-119827829 AAAAATAACAAGTGTTGGTGAGG + Intergenic
979679288 4:123442246-123442268 TAAAATAACAAGTGTTTGTGAGG - Intergenic
979861524 4:125699295-125699317 GAAAGGAACAAGAGACACTGAGG + Intergenic
979915264 4:126424317-126424339 AAAAATAACAAGTGTTGGTGAGG + Intergenic
979936552 4:126704820-126704842 AAAGGTAACAAGTGTTGGTGAGG - Intergenic
980079495 4:128328943-128328965 GAAAATAACAAGTGTTGATGAGG + Intergenic
980296841 4:130930235-130930257 AAAGGTAACAAGTGTTGGTGAGG - Intergenic
980387601 4:132106617-132106639 AAAAGTAACAGGTGTCGGTGAGG + Intergenic
981185225 4:141793671-141793693 GAAAATAGCAAGTGTTGGTGAGG - Intergenic
981500031 4:145439994-145440016 TAAAGTAACAAGAGTCATAGTGG + Intergenic
981682367 4:147414291-147414313 AAAAATAACAAATGCCAGTGAGG - Intergenic
982050959 4:151501431-151501453 GAAAATAACAAGTGTTAGTGAGG - Intronic
982107953 4:152027329-152027351 GACAATAACAAGTGTTAATGAGG + Intergenic
982425904 4:155259642-155259664 AAAAATAACAAGTGTTAGTAAGG - Intergenic
982504028 4:156195751-156195773 GAAAATAACAGATGTCAGTGAGG + Intergenic
982613362 4:157606811-157606833 AAAGATAACAAGTGTCGGTGGGG + Intergenic
983101510 4:163632078-163632100 GAAAATAACAAGTCTTGGTGAGG + Intronic
983308882 4:166030139-166030161 GAAAATAACAAGTGTTGGTGAGG - Intronic
983482737 4:168295073-168295095 AAAGATAACAAGTGTCAGAGAGG + Intronic
984194923 4:176647845-176647867 GAAAATAACAAGTGTTGGTGAGG + Intergenic
984397842 4:179223861-179223883 GAAAGTAACTACTGACAGTAGGG - Intergenic
984757891 4:183340892-183340914 GATAATAACAAGTATTAGTGAGG - Intergenic
984787764 4:183584611-183584633 AATAGTAACAAGTGTTGGTGAGG + Intergenic
984815919 4:183836012-183836034 GGCAGTAACAAGTGTTGGTGAGG - Intergenic
984855569 4:184192978-184193000 GATAATAACAAGTGTTGGTGAGG + Intronic
984955267 4:185038661-185038683 GAAAATAACAAGTGTTGGTGAGG - Intergenic
985111548 4:186551830-186551852 GAAAGCAACAAGTGCAAGAGAGG + Intronic
985331145 4:188836089-188836111 AAAAATAACAAGTGTTAGTGAGG - Intergenic
985513757 5:326735-326757 GAACATAACAAGGGTCAGTGGGG - Intronic
985516880 5:351096-351118 GAAAATAATAAGTGTAGGTGAGG + Intronic
985672992 5:1215879-1215901 GACAATAACAAGTGTTGGTGAGG - Intronic
986652853 5:9981629-9981651 GAAAATAACAAATGTTGGTGAGG + Intergenic
986672535 5:10155587-10155609 GGAAATAACAAGTGTTGGTGAGG + Intergenic
987187427 5:15439010-15439032 GAAAGAAACTAGTGTTGGTGAGG + Intergenic
987277789 5:16379838-16379860 GAAAATAACAAGTGTTGGTATGG + Intergenic
987674204 5:21052732-21052754 GAATGAAAGAAGTGTCAGTGAGG + Intergenic
988877568 5:35464329-35464351 GAAAATAACAAGTGTTGGAGAGG + Intergenic
988976397 5:36520834-36520856 GAAAATATCAAGTCTTAGTGTGG - Intergenic
989013008 5:36895610-36895632 GACAATAACAAGTGTTGGTGAGG - Intronic
989063297 5:37432202-37432224 GAAAATAACAAGTGTTGGTAAGG - Intronic
989116641 5:37960685-37960707 GAAACTAACAAGCGTTGGTGAGG + Intergenic
989132486 5:38121580-38121602 GAAAATAACAAGTATTGGTGAGG - Intergenic
990144906 5:52748817-52748839 GAAAATAACAAGTATTGGTGAGG + Intergenic
990443796 5:55873549-55873571 GACAATAACAAGTGTTGGTGAGG - Intronic
991207269 5:64064115-64064137 AAATGTAACAAGTGTTGGTGAGG - Intergenic
991335682 5:65544379-65544401 GAAAGTAACAAGTGTTAACAAGG + Intronic
991379942 5:66010080-66010102 GAAAGTAACAAGTGTTTGTGAGG - Intronic
991388261 5:66114132-66114154 GAAAATAACAAGTGTTGGGGAGG + Intergenic
991423386 5:66464976-66464998 GAAAATAACAAGTGTTGGTGAGG + Intergenic
991722953 5:69510898-69510920 GACAATAACAAGTGTTGGTGAGG - Intronic
992406884 5:76467482-76467504 GACAATAACAAATGTTAGTGAGG + Intronic
992519132 5:77531493-77531515 GACAATAACAAGTGTTGGTGAGG + Intronic
993087834 5:83385754-83385776 GAAAATAACAAGTGCCAGTGAGG + Intergenic
993114035 5:83697685-83697707 TACAATAATAAGTGTCAGTGAGG - Intronic
993765798 5:91856824-91856846 GAAAGTAACGTGTGTCAATTCGG + Intergenic
993821560 5:92623858-92623880 GAGAATGACAAGTTTCAGTGAGG + Intergenic
994289417 5:98010687-98010709 GAAAGGAATAAGGGTAAGTGGGG - Intergenic
995102089 5:108324429-108324451 GAAAATAACAAGTGTCAGCAAGG + Intronic
995246441 5:109940585-109940607 GATAATAACAAGTGTTGGTGAGG - Intergenic
995489203 5:112672436-112672458 GAAAATAACAAATGTTGGTGAGG - Intergenic
995547010 5:113242858-113242880 AAAAGTAACAGGAGTCAGTCAGG + Intronic
995562506 5:113398177-113398199 AAAAATAACATTTGTCAGTGAGG + Intronic
995845589 5:116490459-116490481 GCAGGTTCCAAGTGTCAGTGAGG + Intronic
995971719 5:117980377-117980399 GAAAATAACAAGTGTTGGTGAGG + Intergenic
996208204 5:120769857-120769879 AAAGAAAACAAGTGTCAGTGAGG - Intergenic
996292520 5:121868918-121868940 AAAAATAACAAGTGTTGGTGAGG + Intergenic
996361879 5:122657740-122657762 GAAAATAACTAGTGTTGGTGAGG + Intergenic
996363409 5:122675446-122675468 GACAATAACAAGTGTTGGTGAGG - Intergenic
996395700 5:123011663-123011685 GAAAATAACAAGTGTTGGTGAGG + Intronic
996438652 5:123464001-123464023 AGATATAACAAGTGTCAGTGAGG - Intergenic
996538534 5:124604437-124604459 GAAAGAATCAAGTGGCTGTGAGG + Intergenic
997114727 5:131113496-131113518 GACAATAACAAGTGTTCGTGAGG + Intergenic
997239806 5:132297979-132298001 GAAAATAACAAGTGTTAGTGAGG + Intronic
997403641 5:133623949-133623971 GAAAATAACAAGTGTTGGTGAGG + Intergenic
997719737 5:136068145-136068167 GAAAATAACAAGTATTAGAGAGG - Intergenic
997783278 5:136681755-136681777 GAAAGTGAAAAGTGTGAGTGTGG + Intergenic
997982431 5:138476888-138476910 GACAATAACAAGTATCAGTGAGG + Intergenic
998258009 5:140603988-140604010 TAAAATAACAAGTGTTGGTGAGG - Intergenic
998301289 5:141023387-141023409 GAAAATAACAAGTGTTAGTGAGG + Intergenic
998699058 5:144676665-144676687 GAAAATAACAAATGTTGGTGAGG + Intergenic
998966806 5:147550028-147550050 GAAAATAACAAGTATCAGCAAGG - Intergenic
999706670 5:154279197-154279219 GAAAACAACAAGTGTTAGTGAGG - Intronic
999740732 5:154549145-154549167 GAAAATATCAAGTGTTGGTGAGG - Intergenic
1000011468 5:157237348-157237370 GATAGTAACAATAGACAGTGGGG + Intronic
1000371790 5:160543668-160543690 AAAAATAACAAATGTCAGTAAGG + Intergenic
1001308309 5:170592095-170592117 GAAAATAACAAGTGTTGGTGAGG - Intronic
1001491378 5:172158117-172158139 GAAAATAACAAGTGTTGGTGAGG + Intronic
1001550572 5:172599365-172599387 GAGAATAACAAGTGTTGGTGAGG + Intergenic
1001800572 5:174540374-174540396 GAAAATAACAAATGTTGGTGAGG + Intergenic
1001969441 5:175942593-175942615 AAAAGTAACAGATGACAGTGAGG + Intronic
1002247994 5:177901160-177901182 AAAAGTAACAGATGACAGTGAGG - Intergenic
1002326389 5:178411142-178411164 GAAAATAACAAGTGTTGATGAGG + Intronic
1002788297 6:420355-420377 GAAAATAACAAGTGTTGGTGAGG - Intergenic
1002852568 6:1009740-1009762 GAAAGTAACAAATGCTGGTGAGG - Intergenic
1003064095 6:2888175-2888197 GAAAATAATAAGTGTTGGTGAGG + Exonic
1003391359 6:5715960-5715982 GATAATAACAAGTGTTGGTGAGG - Intronic
1003595703 6:7472338-7472360 GAAAATAACAAGTGTTGGTGAGG - Intergenic
1003617097 6:7664940-7664962 GACAATAACAAGCGTCGGTGAGG - Intergenic
1003704131 6:8505575-8505597 GTATGTAACGAGTGTCAGGGAGG + Intergenic
1003955380 6:11160176-11160198 GCCAGTAACAAGTGTTAGTGAGG + Intergenic
1004207282 6:13603563-13603585 GAAAATCACAAGTGTTGGTGAGG + Intronic
1004536541 6:16508614-16508636 GAAAATAACAACTGTTGGTGAGG + Intronic
1004700342 6:18073360-18073382 GAAAATAACAAGTGCTGGTGAGG - Intergenic
1004777059 6:18859499-18859521 GAAAGTAACAAGTGTTGGTGAGG - Intergenic
1005613881 6:27554060-27554082 GAAAGTAACTAGGGTCTGTTAGG - Intergenic
1005746795 6:28845968-28845990 GAAAATAACAAGTGTTGGAGAGG + Intergenic
1006278303 6:33023859-33023881 AAAAATAACAAGTGTTAGCGAGG - Intergenic
1006487932 6:34359912-34359934 GAAAATAACAAGTGTTAGTGAGG - Intronic
1006652263 6:35561333-35561355 GAAAATAACAAGTGTTGGTGAGG + Intergenic
1006747371 6:36352965-36352987 GACATTAACAAGTGTCGGAGAGG - Intergenic
1007888237 6:45257086-45257108 GATAGCAACAAGTGTTGGTGAGG - Intronic
1008020187 6:46567617-46567639 GAAAATAACAAGTGTTGGTGAGG - Intronic
1008308168 6:49931482-49931504 AAGAGTAAGAAGTGACAGTGAGG - Intergenic
1008550256 6:52622434-52622456 CAAAATAACAAGTGTTTGTGAGG + Intergenic
1009467882 6:63995393-63995415 GAAAATAACAAGTCTTAGTGAGG + Intronic
1009783927 6:68306438-68306460 AAAAGCAACAAGTGCTAGTGAGG + Intergenic
1010104931 6:72155960-72155982 GAAGATAACAAGTGTTGGTGAGG + Intronic
1010139746 6:72600771-72600793 GACAATAACAAGTGCCGGTGAGG - Intergenic
1010174500 6:73011961-73011983 GAAAATAACAAATGTTGGTGAGG + Intronic
1010601363 6:77831243-77831265 AATAGTAACAAATGTTAGTGAGG + Intronic
1010771863 6:79841054-79841076 GAAAGGAACAAGGATCAATGAGG + Intergenic
1011485344 6:87835033-87835055 GAAAGTAACATATCTCATTGTGG + Intergenic
1011701886 6:89963225-89963247 CAGAGTAACAAGTGTCAGCGAGG + Intronic
1011715505 6:90100901-90100923 GACAGTAATAAGTGTTGGTGAGG - Intronic
1011776149 6:90732981-90733003 GATAATAACAAATGTCAGTGAGG - Intergenic
1012343784 6:98161100-98161122 GAAAATACCAAATGTCACTGAGG + Intergenic
1012589281 6:100960004-100960026 GAAAATAACAAGTGTTGGTGGGG - Intergenic
1012937520 6:105383701-105383723 GATAGTAACTAGTCCCAGTGAGG - Intronic
1013253013 6:108353554-108353576 GAAAATAACAAGTGTTAGCAAGG - Intronic
1013320427 6:108982619-108982641 CAAAATAACAAGTGTTGGTGAGG - Intergenic
1013337493 6:109179094-109179116 GATAGTAACAAGTGTTAGCAAGG + Intergenic
1013343073 6:109234308-109234330 GAAAATAACAAATGTTGGTGAGG + Intergenic
1013376850 6:109525652-109525674 GAAAATAACAGATGTTAGTGAGG + Intronic
1013567843 6:111386440-111386462 GATAATAACAAGTGTTAGTGAGG + Intronic
1013875023 6:114814815-114814837 GAAAATAAAAAGTGTTGGTGAGG - Intergenic
1014011313 6:116479168-116479190 AAAAATAACAAGTGTTAGTGAGG - Intergenic
1014636365 6:123851647-123851669 GAAACTAACAAGTCTTGGTGAGG - Intronic
1014659368 6:124148956-124148978 GACAATAACAAGTGTTGGTGAGG - Intronic
1014659608 6:124152503-124152525 GAAAATAACAAGTGTTGATGAGG + Intronic
1015598025 6:134884632-134884654 AAAATTAACAAATGCCAGTGAGG + Intergenic
1015898708 6:138042193-138042215 GAAAATAACAAATGTTGGTGAGG - Intergenic
1016195202 6:141327852-141327874 AAAGGTAAGAAGTGTTAGTGAGG + Intergenic
1016473068 6:144395872-144395894 GAAAATAACAAATATTAGTGAGG + Intronic
1016864657 6:148753825-148753847 GAAAATAAGAAATGGCAGTGAGG - Intronic
1017175509 6:151500092-151500114 GAAAATAACAAGTGGGGGTGAGG - Intronic
1017200170 6:151744372-151744394 GACAATAACAAATGTCGGTGAGG - Intronic
1017287437 6:152692165-152692187 GAAGAAAACAAGTATCAGTGAGG - Intergenic
1017401109 6:154064124-154064146 GAAAATAACAAGTGTTGGTGGGG - Intronic
1017461149 6:154651778-154651800 GAAGATAACAAGTGTTAGAGAGG - Intergenic
1017474415 6:154773759-154773781 GACAGTAACAAGTGTAAGCAAGG - Intronic
1017890946 6:158639019-158639041 GAAAATAACAACATTCAGTGAGG + Intronic
1019084745 6:169465387-169465409 CAAAATAAAAAGTGTCAGTGAGG + Intronic
1019755636 7:2766884-2766906 CAAAATAACAAGTGTTGGTGAGG - Intronic
1019863038 7:3678124-3678146 AAAATTAACAAGTGTTGGTGAGG + Intronic
1019889577 7:3935735-3935757 GAAAGTAACAAGTGTTGGCAAGG + Intronic
1019964582 7:4488320-4488342 GAAAATTACAAGTGTTGGTGAGG + Intergenic
1020488743 7:8751736-8751758 GAAAGTAAGGTGTGTCACTGTGG - Exonic
1020723179 7:11775189-11775211 GAAAATAACAAGTGTTAATAAGG + Intronic
1020826331 7:13033880-13033902 AAAAATAACAAGTGTTGGTGAGG + Intergenic
1020926977 7:14340899-14340921 GAAAGTAACTTGTCACAGTGGGG - Intronic
1021031823 7:15746609-15746631 GACAATAACAAATATCAGTGAGG + Intergenic
1021436337 7:20620734-20620756 GAAAATAACAAGTGTTAGTGAGG + Intronic
1021498321 7:21301136-21301158 GAAAATAACAGGTATTAGTGAGG + Intergenic
1021548099 7:21838987-21839009 GACAGTAACAAGTGTTGGTGAGG - Intronic
1021690379 7:23224969-23224991 GAAAATAACAAGTGTTGGTGAGG - Intergenic
1022170395 7:27822527-27822549 GACAGTAACAAGTGTGGCTGAGG - Intronic
1022214867 7:28248932-28248954 GAAAACAACAAGTGTTGGTGAGG + Intergenic
1022335739 7:29420113-29420135 AAAAGTAACAAGTGTTGGTATGG + Intronic
1022388029 7:29919821-29919843 GAAAATAACAAATGTGGGTGAGG - Intergenic
1022687094 7:32607429-32607451 GAAAATAACCAATGTTAGTGAGG + Intergenic
1023036350 7:36134704-36134726 GAAAATAACAAGAGTTGGTGAGG + Intergenic
1023450882 7:40283664-40283686 GATAATAACAAGTGTTGGTGAGG + Intronic
1023877846 7:44298886-44298908 GAAAATAACAAGTGTTGGTGAGG + Intronic
1023891581 7:44396062-44396084 GAAGATAACAAGTGTTGGTGAGG - Intronic
1023997065 7:45166164-45166186 AAAAAAAAAAAGTGTCAGTGAGG - Intronic
1024026800 7:45416680-45416702 GAAAATAACAAGTGTTGGTGAGG + Intergenic
1024280767 7:47717673-47717695 GACAACAATAAGTGTCAGTGAGG + Intronic
1024488552 7:49948709-49948731 GAAAATAACTAGTGTTGGTGAGG + Intronic
1024537200 7:50446980-50447002 GATAGTGACAAGTGGCAGTCTGG - Exonic
1025237153 7:57242488-57242510 GAAAATCACAAGTGTTGGTGAGG - Intergenic
1025292083 7:57737735-57737757 GAAAGTATCAAGTGATAGTGAGG - Intergenic
1027248292 7:76381968-76381990 GAAAATAACAAATGTTGGTGAGG + Intergenic
1027554058 7:79640896-79640918 GAAATTAAGAAGTGACAGTGAGG + Intergenic
1028823848 7:95245935-95245957 GAATGTAAGCAGTGTGAGTGCGG + Intronic
1028893948 7:96020117-96020139 GAAAATAGCAAGTGTTGGTGGGG + Intronic
1029071240 7:97900387-97900409 GAAAATAACAAGTTTTGGTGAGG + Intergenic
1029220603 7:98986430-98986452 GAAAATAACAAGTGCTGGTGAGG - Intronic
1029242816 7:99176418-99176440 GAAAATAACAAGTGTCGGCAAGG + Intronic
1030068885 7:105681394-105681416 GAAAATAACAAGTCTTGGTGAGG + Intronic
1030097996 7:105918358-105918380 GAAAATAACAAGTGTTGGTGAGG - Intronic
1030241225 7:107327791-107327813 GTAAATAACAAGTCTCAGCGAGG + Intronic
1030284159 7:107808370-107808392 GAAAATACCAAGTGTCACAGAGG + Intergenic
1030296617 7:107935091-107935113 AAAAGGATCAAGTTTCAGTGCGG + Intronic
1030645800 7:112060312-112060334 GAAACTAACAAATGTTGGTGAGG + Intronic
1030994549 7:116342785-116342807 GAAAATAACAAATGTTGGTGAGG - Intronic
1031382545 7:121105352-121105374 GAAAGTATAAAGTGACAGTATGG + Intronic
1031555775 7:123174331-123174353 GAAAATGAGAAGTGTCATTGTGG - Intronic
1031933842 7:127715123-127715145 GAAAATAACAAATGTTGGTGAGG - Intronic
1032099847 7:128965434-128965456 GAAAATAACAAGTGTTGGTGAGG + Intronic
1032161929 7:129517450-129517472 GACAGTGACAAGTGTCAGCGAGG + Intergenic
1032185766 7:129724373-129724395 GAAAATAACAAGTGTTGGTGAGG + Intronic
1032340186 7:131064479-131064501 GAAAATAACAAGTCTTGGTGAGG + Intergenic
1032446537 7:131988907-131988929 GAAAATAACAAGTGTTGGTAAGG + Intergenic
1032494485 7:132350631-132350653 GAAAATGACAAGTGTTGGTGAGG + Intronic
1033074118 7:138232763-138232785 GAAAGTAACAAATTTTAGGGGGG - Intergenic
1033369084 7:140692973-140692995 GAAAATGACAAGTGTTGGTGAGG - Intronic
1033462373 7:141558775-141558797 GAAAATAACAAGTGTTGATGAGG - Intronic
1033594454 7:142846512-142846534 GCAAGTAAAAAGTGTTGGTGAGG - Intergenic
1034138431 7:148793894-148793916 GAAAATAACAAATGTTGGTGAGG - Intronic
1034249724 7:149678903-149678925 GAAAATAACAAGTGTTGGAGAGG - Intergenic
1034586412 7:152097345-152097367 GAGAGTAGCAAGCGACAGTGAGG + Intronic
1034685168 7:152964658-152964680 GACAGTACCAAGTGTTGGTGAGG - Intergenic
1035829197 8:2676262-2676284 GAAAGGAAAACGTGTGAGTGCGG + Intergenic
1036187041 8:6631673-6631695 GAAAATAACAAGTGTTAGTAAGG + Intronic
1036246474 8:7121598-7121620 GAAAATAACAAGTGTTGGTGAGG - Intergenic
1036254328 8:7192821-7192843 GAAAATAACAAGTGTTGGTGAGG + Intergenic
1036363166 8:8094667-8094689 GAAAATAACAAGTGTTGGTGAGG - Intergenic
1036416960 8:8559749-8559771 GAGAATAACAAGTGTTAGTGAGG + Intergenic
1036634070 8:10536355-10536377 GAAAATAACAAATGTTGGTGAGG + Intronic
1036887805 8:12572405-12572427 GAAAATAACAAGTTTTGGTGAGG + Intergenic
1036895393 8:12630513-12630535 GAAAATAACAAGTGTTGGTGAGG + Intergenic
1036941123 8:13053549-13053571 AAAAGAAACAAGTATTAGTGAGG - Intergenic
1037475793 8:19256602-19256624 CTAAGTAAAAAGTGTCAGTCTGG + Intergenic
1037673052 8:21031689-21031711 AATAGTAACAAGTGTTGGTGAGG - Intergenic
1037954961 8:23049058-23049080 GAAAATAACAAGTGCTGGTGAGG + Intronic
1038154620 8:24977089-24977111 GAAAATAACAAATGTTGGTGAGG - Intergenic
1038835297 8:31113836-31113858 GAAAGCAACAAGGGGCACTGGGG - Intronic
1038946534 8:32367291-32367313 GAAAGTAATAAATGTCAGTGAGG - Intronic
1039198148 8:35055449-35055471 GAAAATAACAGATGCCAGTGAGG - Intergenic
1039337395 8:36607088-36607110 GAAAGAAGCAAGTGACAGTCAGG - Intergenic
1039367683 8:36948306-36948328 GAAAATAACAAGTGTTAGCAAGG + Intergenic
1040847240 8:51856352-51856374 TGAAGTAACAAGTATTAGTGAGG + Intronic
1040959519 8:53017413-53017435 GAAAATAACAAGTGCTGGTGAGG - Intergenic
1041253596 8:55959105-55959127 GAAAATAACAACTGTTGGTGAGG - Intronic
1041256870 8:55986326-55986348 GAAAATAACAAGTGTTAGTGAGG - Intronic
1041328310 8:56694152-56694174 GAAAATAAGAAGTGTGGGTGAGG + Intergenic
1041328360 8:56694865-56694887 GAAAATAACAAGTGCTAGTGAGG - Intergenic
1041593735 8:59621615-59621637 GAAAATAACAAATGTTGGTGAGG - Intergenic
1042170365 8:65985365-65985387 GAAAGCAGCAACTGGCAGTGTGG + Intergenic
1042469614 8:69169644-69169666 AAAAATAACAAGTGTTAGGGAGG - Intergenic
1042578872 8:70254235-70254257 GAAAATAATAAGTGTTGGTGAGG + Intronic
1042811069 8:72825543-72825565 GAAAATAACAAGCATCAGGGAGG - Intronic
1043139803 8:76573935-76573957 GAGAATAAAAAGTATCAGTGTGG - Intergenic
1043206002 8:77441288-77441310 AAAAATAACAAGTGTCAGTAAGG - Intergenic
1043229116 8:77777051-77777073 GAAAATAACAAGTGTTGGTGAGG + Intergenic
1043558980 8:81468586-81468608 GAAAATAACAAGTGTTAGCAAGG - Intergenic
1043659436 8:82717797-82717819 GAAAATAACAAGTGCTGGTGAGG + Intergenic
1043867489 8:85392625-85392647 GGAGGTAACAAGAGTCAGTCTGG + Intronic
1043987356 8:86709251-86709273 AAATGTAACATGTGTCTGTGTGG - Intronic
1044134204 8:88564116-88564138 AAAAATAACAAATGCCAGTGAGG + Intergenic
1044146380 8:88719843-88719865 AAAAATAACAAGTGTTGGTGAGG + Intergenic
1044229075 8:89754637-89754659 GAATATACCAAGTGTGAGTGAGG - Intergenic
1044236274 8:89834268-89834290 GAAAATAACAAGTATTGGTGAGG + Intergenic
1044374496 8:91453506-91453528 GACAGTAACAAGTGACAGAATGG - Intergenic
1044498310 8:92918372-92918394 AAAAATAACAAGTGTTGGTGGGG - Intronic
1044638609 8:94354560-94354582 GAAAATAAGAAGTGTTGGTGAGG + Intergenic
1044648037 8:94465506-94465528 GAAAATAACAAGTGTTCCTGAGG + Intronic
1044789000 8:95826635-95826657 GAAAATAACAAGTGGGGGTGAGG - Intergenic
1044816935 8:96123134-96123156 GAAAATAACAAGTGTTGGTGAGG - Intergenic
1045004493 8:97906184-97906206 GAAAATAACAAGTATTGGTGAGG - Intronic
1045149895 8:99393353-99393375 GAAATTAATAATTGTTAGTGAGG + Intronic
1045697272 8:104823695-104823717 AAAAGTAACAGATGTTAGTGAGG + Intronic
1046092304 8:109518281-109518303 GAAAGAAACAAATATCACTGTGG - Exonic
1046274692 8:111942888-111942910 GAAAATAACAAGCGTTGGTGAGG + Intergenic
1046296531 8:112226914-112226936 GAAAATAACAAGTGTTGGTTAGG + Intronic
1046935233 8:119879170-119879192 GACAGTCACAAGTGTTTGTGAGG + Intronic
1047140264 8:122130709-122130731 AAAAATAACAAGTGTTAGAGAGG + Intergenic
1047158843 8:122353268-122353290 GAAAATAACAAGTGTCAACAAGG + Intergenic
1047265270 8:123301740-123301762 GAAAATTACAAGTGTTGGTGTGG - Intergenic
1047548632 8:125844784-125844806 GTAAGAAACTAGTGACAGTGTGG - Intergenic
1047627509 8:126671398-126671420 GAAGATAACAAGTGTTGGTGAGG + Intergenic
1047755399 8:127914305-127914327 GAAAATAGCAAGTGTTGGTGAGG + Intergenic
1048107867 8:131430982-131431004 GAAAGGAACAAGAGACAGTGAGG - Intergenic
1048325998 8:133439667-133439689 GAAACTAACAAGTGTTGGTGAGG - Intergenic
1048389730 8:133950940-133950962 GAAAATAACAAGTGTTGGTGGGG + Intergenic
1048996474 8:139796893-139796915 GATAGTAACAAGTGTTGCTGAGG - Intronic
1049074285 8:140381798-140381820 GACAATAACAAGTGTTAATGAGG + Intronic
1049107213 8:140621783-140621805 GATAGTAACAAGTGTTGATGAGG + Intronic
1049692552 8:143968845-143968867 GATAATAACAAGTGTTGGTGAGG + Intronic
1050530358 9:6583056-6583078 GAAAATAACAAATGTTGGTGGGG + Intronic
1050580321 9:7047797-7047819 GATAGAACCCAGTGTCAGTGGGG + Intronic
1051317188 9:15852229-15852251 GAAACTAACAAGTGTGAGCAAGG - Intronic
1051357306 9:16251523-16251545 GAAAATATCAAGTGTTGGTGAGG + Intronic
1051455517 9:17252393-17252415 GAAAATAACAGATGTAAGTGAGG - Intronic
1051500620 9:17772982-17773004 GAAAATAACAAGTGTTAGCAAGG - Intronic
1051511495 9:17883348-17883370 GATAATAACAAATGTCGGTGAGG - Intergenic
1052483359 9:29062180-29062202 GAAAATAACAAGTGTTGGTAAGG + Intergenic
1052576431 9:30298256-30298278 GAAAGGAACAATAGTCACTGGGG - Intergenic
1052912262 9:33894112-33894134 GAAAATAACAAGTGTTGGTAAGG - Intronic
1053231185 9:36411260-36411282 GAAAATAACAAGTGTTGGCGAGG + Intronic
1053708312 9:40778634-40778656 GAAAATAACAAGGGTTAGTGAGG - Intergenic
1054164418 9:61707962-61707984 GAAAGTATCAAGTGATAGTGAGG + Intergenic
1054418221 9:64899424-64899446 GAAAATAACAAGGGTTAGTGAGG - Intergenic
1054980026 9:71195453-71195475 AAAAATAACAGGTGCCAGTGAGG + Intronic
1055024289 9:71702998-71703020 GAAACAAACAATTGTCAGAGAGG - Intronic
1055477782 9:76680383-76680405 GAAAATAACAAGTGTTGGTGAGG + Intronic
1055512309 9:77007129-77007151 GAAAGTAAAAAGGCTGAGTGGGG - Intergenic
1055766881 9:79672908-79672930 TAAAGAAACAAGTGCAAGTGAGG + Intronic
1056024040 9:82473909-82473931 GAAAATAACAAGTGTTGGTAAGG + Intergenic
1056095516 9:83249794-83249816 GAAAATAACAAGTGTTGGTGAGG + Intronic
1056131070 9:83587016-83587038 AAAAATAACAAGTGTTGGTGAGG + Intergenic
1056398562 9:86204407-86204429 AAATATAACAAGTGTCGGTGAGG - Intergenic
1056931848 9:90884039-90884061 GAAAATCACAGGTGTCACTGAGG + Intronic
1057034663 9:91803031-91803053 GAAAATAACAAGTTTTGGTGAGG + Intronic
1057043253 9:91863063-91863085 CACAATAACAAGTGTTAGTGAGG + Intronic
1057281771 9:93718076-93718098 GAAAATAATAAGTGTTGGTGAGG - Intergenic
1057301228 9:93884856-93884878 GAAAATAACAAGTGTTAGCAAGG + Intergenic
1057374558 9:94507860-94507882 AAAGGTAACAAGTGTTGGTGAGG + Intergenic
1057584705 9:96318865-96318887 GAAAATAACAAATGTTATTGAGG + Intergenic
1057673383 9:97115941-97115963 GAAAATGGCAAGTGTCAATGAGG + Intergenic
1057864719 9:98670333-98670355 GAAAATAACAAGTGTTGATGAGG + Intronic
1058108994 9:101009799-101009821 GAAAGTAGAAAATGGCAGTGAGG + Intergenic
1059053208 9:110951627-110951649 GAAAATGTCAAGAGTCAGTGAGG + Intronic
1059130692 9:111745656-111745678 GAAAGAACCAAGTGTCAGCCGGG - Intronic
1059154212 9:111975739-111975761 AAAAGTAAGAAGTCTCACTGTGG + Intergenic
1059194909 9:112361889-112361911 GAAAGTAACAAGTGTCGGATGGG - Intergenic
1059226451 9:112677524-112677546 GAAAATAACAAATGTTGGTGAGG - Intergenic
1059255197 9:112924065-112924087 GAAAATAACAAGTGTTGGTGAGG - Intergenic
1059473571 9:114525678-114525700 GAATGTAATAAGAGTCAGTAGGG - Intergenic
1060014619 9:120076314-120076336 AAAGGCACCAAGTGTCAGTGAGG + Intergenic
1060469480 9:123935919-123935941 CAAAATAACAAGTGTTGGTGAGG - Intergenic
1060473697 9:123969709-123969731 GAAAATAACAAGTGTTGGTGAGG - Intergenic
1060843300 9:126812563-126812585 GACAATAACAGGTGTCGGTGAGG - Intronic
1061901629 9:133675528-133675550 GAAAGTAACGAGTGTTGGTGAGG + Intronic
1062704276 9:137926688-137926710 GAAATTAACAAGTATTGGTGAGG - Intronic
1203425806 Un_GL000195v1:36118-36140 GAAAATCACAAGTGTTGGTGAGG - Intergenic
1203444594 Un_GL000219v1:43697-43719 GAAAATCACAAGTGTTGGTGAGG - Intergenic
1185954148 X:4470839-4470861 GACAGTGTCAAGTGTCATTGTGG + Intergenic
1186039300 X:5458159-5458181 GAAAATAACCAGTGTTTGTGAGG - Intergenic
1186251698 X:7674539-7674561 GAAAATAACAAGTGTTGGTGAGG + Intergenic
1186396535 X:9214330-9214352 GACAATAACAAGTGTTGGTGAGG + Intergenic
1186420765 X:9424224-9424246 GAAAATAACAAGTGTTGGTGAGG - Intergenic
1186680902 X:11872875-11872897 TAAAATAACAAGTGTCTGTGAGG + Intergenic
1186764435 X:12756387-12756409 GAAAAGAACAAGTGTTGGTGAGG + Intergenic
1186860929 X:13671767-13671789 GAAAATAACAAGTGTTGGTGAGG + Intronic
1186879270 X:13848598-13848620 GACAATAACAAGTGTTAGTGAGG + Intronic
1186890032 X:13950886-13950908 GAAAATAACAGGTGTTGGTGAGG - Intergenic
1186970418 X:14835765-14835787 GAAAATAACAAGTGTTAGGAAGG + Intergenic
1186995132 X:15113327-15113349 GATAGTAACAAGTGTTGGCGAGG - Intergenic
1187037534 X:15557578-15557600 GAAGATAACAAGAGTCATTGAGG + Intergenic
1187087641 X:16058197-16058219 GACAAAAACAAGTGTAAGTGAGG + Intergenic
1187124578 X:16442783-16442805 GAGAATAACAAGTGTTGGTGAGG + Intergenic
1187129279 X:16486216-16486238 GACAATAACAAGTGTTGGTGAGG + Intergenic
1187184957 X:16975364-16975386 AAAAGAAACAGGTGCCAGTGAGG - Intronic
1187309825 X:18131135-18131157 AAAGGTAACAAGTGTTGGTGAGG + Intergenic
1187362223 X:18639497-18639519 GACAGTAACAAGTGTTGCTGAGG + Intronic
1187379757 X:18790093-18790115 GACAATAACAAGTGTTAGAGAGG - Intronic
1187630734 X:21168370-21168392 GAAAATAACAAGTGTTGGAGAGG + Intergenic
1187630961 X:21171599-21171621 GAAAATAACAAGTGTTGGTGAGG - Intergenic
1187941713 X:24388980-24389002 GAAAATAGCAAGTGTGGGTGAGG - Intergenic
1187961343 X:24569288-24569310 GAAAATAACAAGTGTTGGTGAGG + Intronic
1188038930 X:25349763-25349785 GAAAATAACAAGTGTTGGTGAGG - Intergenic
1188163840 X:26836661-26836683 GAAAATAACAAGTTTTGGTGGGG - Intergenic
1188296165 X:28451798-28451820 GAAAATAACAAGTGTTTGCGAGG - Intergenic
1188318458 X:28706059-28706081 GAAAATAACAAGTGTCATCAAGG - Intronic
1188460264 X:30417581-30417603 GACAGTAACAAGCGTTTGTGAGG + Intergenic
1188816322 X:34718945-34718967 GAAAATACCAAGTGTTAGTGAGG + Intergenic
1188875095 X:35419771-35419793 GAAAACAACAAGTGTTGGTGAGG - Intergenic
1188903528 X:35763422-35763444 GAAAATAACAAGTTTTGGTGAGG + Intergenic
1188992172 X:36834814-36834836 GAAAATAAGAAGTGTTGGTGAGG + Intergenic
1189191204 X:39107843-39107865 GAAAATAACAAGTATTGGTGAGG - Intergenic
1189541491 X:41995764-41995786 GATAATAACATGTGTTAGTGAGG + Intergenic
1190011510 X:46789221-46789243 GTAAATAACAAGTCTGAGTGAGG - Intergenic
1190052899 X:47164611-47164633 CAAAATAACAAGTGTTGGTGAGG + Intronic
1190366551 X:49700118-49700140 GAAAATAACAAGTGTTGCTGAGG - Intergenic
1190861783 X:54352269-54352291 GAAAGCAACAAGTGTTGGTGAGG + Intronic
1191593904 X:62921548-62921570 AAAATTAACAAGTGTTGGTGAGG + Intergenic
1192225609 X:69225696-69225718 GAAAATAACAAGTGTGTGTAAGG + Intergenic
1192258830 X:69490964-69490986 GATATTAACAAGTGTTGGTGAGG + Intergenic
1192488293 X:71550230-71550252 AATAATAACAAGTGTTAGTGAGG - Intronic
1192536319 X:71931047-71931069 GAAAATAACAAGTATTGGTGAGG - Intergenic
1192604764 X:72504847-72504869 GAAAATAACAAGTGCTGGTGAGG - Intronic
1193041592 X:77009535-77009557 CAGAGTAACAAGTTTCACTGGGG + Intergenic
1193134899 X:77959973-77959995 GACAATACCAAGTGTCGGTGAGG - Intronic
1193434991 X:81462213-81462235 GAAGGAAACAAGTGTTGGTGAGG - Intergenic
1193470919 X:81902344-81902366 GAAAATAACAAGTGTTGGTGAGG - Intergenic
1193499316 X:82254625-82254647 AACAGTAACAGATGTCAGTGAGG - Intergenic
1193671467 X:84391598-84391620 AAAAATAACAAATGTTAGTGAGG - Intronic
1193864766 X:86718147-86718169 AAAAATAACAAGTGTTTGTGAGG - Intronic
1194582523 X:95694027-95694049 GAAAGCAAAAAGTGGCAGTGAGG + Intergenic
1194750203 X:97675702-97675724 GAAAATAAAAAGCGTTAGTGAGG - Intergenic
1194750561 X:97679601-97679623 GAAAATAACAAGTGTTAGTGAGG + Intergenic
1194754092 X:97716676-97716698 GAAAATAACAAGTGTTGGTAAGG - Intergenic
1195238739 X:102929239-102929261 GAAAATACCAAGTGTTGGTGAGG - Intergenic
1195795207 X:108639879-108639901 GTAAATAACAAGTGTTGGTGAGG + Intronic
1195927699 X:110042673-110042695 GAAAATAACAAGTGCTGGTGAGG - Intronic
1195930372 X:110068478-110068500 GAAAGTAACAATTCTCATTATGG + Intronic
1196035114 X:111135464-111135486 GAGAATCACTAGTGTCAGTGGGG + Intronic
1196125078 X:112088707-112088729 GAAAATAACCAGTGTTGGTGAGG - Intergenic
1196262670 X:113602929-113602951 GGAAATAACAAGTGTTAGTGAGG + Intergenic
1196311810 X:114176837-114176859 GAAAATAACAAGTGGCGGTAAGG - Intergenic
1196402797 X:115333695-115333717 GATAATAACAAGTGTCAGGGAGG + Intergenic
1196800091 X:119534955-119534977 AAAAATAACAAGTGTTGGTGAGG + Intergenic
1196871134 X:120114789-120114811 GAAAATAACAAGTGTTGGTGAGG + Intronic
1197173299 X:123458038-123458060 GCAATTAACAAGTGACACTGTGG + Intronic
1197444982 X:126542376-126542398 GAAAATAACAAGTGTTGGTGAGG + Intergenic
1197659881 X:129158679-129158701 GATACTAACAAGTGTTGGTGAGG - Intergenic
1197945713 X:131837403-131837425 GATAATAACAAGTGTCAGTAAGG + Intergenic
1197973462 X:132139453-132139475 AAAAATAACAGTTGTCAGTGAGG - Intergenic
1198109433 X:133489713-133489735 GAAAATAATAAGTGTTGGTGAGG - Intergenic
1198124753 X:133631762-133631784 GAAAATAACAAGTGTTGGGGAGG - Intronic
1198124808 X:133632393-133632415 TAAAGTAACAAGTGTTGGTGGGG - Intronic
1198191769 X:134314467-134314489 AATAATAACAAGTGTCAATGGGG + Intergenic
1198406014 X:136313303-136313325 GACAATAACAAGTGTTGGTGAGG - Intronic
1198446518 X:136722652-136722674 GACAATAACAAGTGTTGGTGAGG + Intronic
1198473749 X:136975361-136975383 GATAGTAACAAGTGTTGGTGAGG - Intergenic
1198481241 X:137043189-137043211 GAAACCAACAAGTGTTGGTGAGG - Intergenic
1198558054 X:137817130-137817152 GAAAACAACAAGTATTAGTGAGG - Intergenic
1198649135 X:138841577-138841599 CAAAGTAACATGAGTCACTGAGG + Intronic
1198719420 X:139599652-139599674 GATAATAACAAGTGTTGGTGAGG + Intronic
1198817281 X:140605338-140605360 GAAAGTACCAAGTATCGGTGAGG - Intergenic
1198911695 X:141622177-141622199 GAAAATAACAAGCGTCGGTGAGG - Intronic
1199712658 X:150481364-150481386 GAAAATAACAAGTGATGGTGAGG + Intronic
1199968679 X:152842361-152842383 GAAAATAGCAAGTGTCAGTGAGG - Intronic
1200086291 X:153608396-153608418 GAAAATAACAAGTGTCTGTTTGG + Intergenic
1200315276 X:155126118-155126140 GAGAATAACAAGTGTTGGTGAGG + Intronic
1200368907 X:155700283-155700305 GAAAATAACAAGTGTTGTTGAGG + Intergenic
1201547662 Y:15183841-15183863 GAAAATAACCAGTGTTTGTGAGG + Intergenic
1201671388 Y:16525356-16525378 TAAAGTCACAAGTGTTGGTGAGG - Intergenic