ID: 950618081

View in Genome Browser
Species Human (GRCh38)
Location 3:14178421-14178443
Sequence TTCGCGGGAGACGCCGCCGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 44
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 38}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950618081_950618092 22 Left 950618081 3:14178421-14178443 CCACCGGCGGCGTCTCCCGCGAA 0: 1
1: 0
2: 1
3: 4
4: 38
Right 950618092 3:14178466-14178488 CCTCCTCCTCCTCCTCACGCCGG 0: 1
1: 1
2: 36
3: 207
4: 911
950618081_950618093 23 Left 950618081 3:14178421-14178443 CCACCGGCGGCGTCTCCCGCGAA 0: 1
1: 0
2: 1
3: 4
4: 38
Right 950618093 3:14178467-14178489 CTCCTCCTCCTCCTCACGCCGGG 0: 1
1: 2
2: 24
3: 128
4: 767

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950618081 Original CRISPR TTCGCGGGAGACGCCGCCGG TGG (reversed) Exonic