ID: 950618081

View in Genome Browser
Species Human (GRCh38)
Location 3:14178421-14178443
Sequence TTCGCGGGAGACGCCGCCGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 44
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 38}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950618081_950618092 22 Left 950618081 3:14178421-14178443 CCACCGGCGGCGTCTCCCGCGAA 0: 1
1: 0
2: 1
3: 4
4: 38
Right 950618092 3:14178466-14178488 CCTCCTCCTCCTCCTCACGCCGG 0: 1
1: 1
2: 36
3: 207
4: 911
950618081_950618093 23 Left 950618081 3:14178421-14178443 CCACCGGCGGCGTCTCCCGCGAA 0: 1
1: 0
2: 1
3: 4
4: 38
Right 950618093 3:14178467-14178489 CTCCTCCTCCTCCTCACGCCGGG 0: 1
1: 2
2: 24
3: 128
4: 767

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950618081 Original CRISPR TTCGCGGGAGACGCCGCCGG TGG (reversed) Exonic
903740127 1:25553944-25553966 CACGCGGGAGACGCTGCTGGAGG + Exonic
909629856 1:77759857-77759879 ATCGCCGGAGACGCCTGCGGCGG - Intergenic
923163381 1:231337299-231337321 GTCGCGGGAGGCACCCCCGGGGG + Exonic
923163750 1:231339582-231339604 ATCGCGGGAGGCGCCCGCGGGGG + Intronic
1091286822 11:134412441-134412463 TCCGCGGGGGACGGTGCCGGGGG - Intergenic
1103407455 12:120686353-120686375 CTGGCGGGAGTCGCCGCCGGCGG - Intergenic
1105039461 12:132950215-132950237 TTTGCTGGAGAAGCAGCCGGAGG - Intronic
1113200742 13:107866175-107866197 TCCCCGGGAGACGGCGGCGGCGG - Exonic
1125814895 15:42575770-42575792 TCCGCGGGAGAGGGCGCCTGAGG + Intronic
1132568439 16:633759-633781 CACGCGGGCGATGCCGCCGGCGG - Exonic
1133006304 16:2883497-2883519 ATCGCGGGAGACCCCACAGGAGG - Intronic
1133011122 16:2912285-2912307 ATCGCGGGAGACCCCACAGGAGG - Intronic
1135250884 16:20900364-20900386 TTCGGGGCGGCCGCCGCCGGTGG - Exonic
1135952760 16:26930666-26930688 TTCGGGGGAAACCCTGCCGGTGG - Intergenic
1142741534 17:1934547-1934569 TTGGCGGGAGGAGCCGCAGGGGG - Intergenic
1142752769 17:1998428-1998450 CTCGCGGGAGCCGCCGGCCGGGG + Intronic
1144565054 17:16353144-16353166 GTCGCGGGAGTCGGCGGCGGCGG + Exonic
1145815783 17:27793898-27793920 TCCGCGGCAGACGCCGGCTGCGG - Intronic
1146283556 17:31559880-31559902 TTCCCGGGGAACGCCGCCTGAGG + Intergenic
1147648886 17:42050730-42050752 TGGGCGGGAGGCGCCGCAGGTGG - Intronic
1160772010 19:836553-836575 ATCGCAGGTGACGCCGCCTGGGG - Intergenic
1162773614 19:12965506-12965528 GTCCCGGGAGCCGCCGCCAGAGG + Intronic
1166840361 19:45693329-45693351 CTCGCGGGTGACGGCGCCCGGGG + Intronic
1166984145 19:46649580-46649602 TGCGCAGGCGCCGCCGCCGGGGG - Exonic
932567934 2:72921067-72921089 TTCGCTGGAGAGGCCGCCGCCGG - Intronic
939153740 2:138501478-138501500 TCCGCGGGAGACGCCAAAGGCGG - Intergenic
1176005768 20:62861634-62861656 ACCGCGGGAGCCGCCGCCGGAGG - Exonic
1180875068 22:19171374-19171396 GTCCCGGGAGGCGCCGCCAGAGG + Intergenic
950618081 3:14178421-14178443 TTCGCGGGAGACGCCGCCGGTGG - Exonic
983649791 4:170026504-170026526 TTCGCGGCAGCCGCGGGCGGGGG + Intronic
985129731 4:186727020-186727042 GGCGTGGGAAACGCCGCCGGAGG - Intergenic
989584815 5:43066509-43066531 TTCCCGGGCGACGCCGGCGCTGG - Intronic
1002455901 5:179345222-179345244 TTCGCGGGCGGCGGCGGCGGCGG + Exonic
1003212346 6:4079133-4079155 TTGCCGGGAGACCCGGCCGGTGG - Exonic
1011418914 6:87152046-87152068 TTCGCGGGCGGCGGCGGCGGCGG + Intergenic
1013048875 6:106512636-106512658 TTCGTGGGGGACGAAGCCGGGGG - Exonic
1014104660 6:117548195-117548217 TACGGGGGAGAAGCCGCCCGAGG - Intronic
1034659860 7:152759783-152759805 CTCGCGGGAGACGCTGCGCGCGG + Exonic
1037826752 8:22164664-22164686 TCCTCCGGAGACGCCGCTGGAGG - Intergenic
1037928778 8:22865325-22865347 GCAGCGGGAGACGCCGCAGGGGG - Intronic
1039454320 8:37697383-37697405 TTTGCGGGAGTCGCCGCCGCCGG - Exonic
1042246375 8:66712699-66712721 TCCGCGGGAGGAGCCGCCAGCGG + Intronic
1043428453 8:80171539-80171561 TTCGCGGGAGTCGCCGGCGGAGG - Intronic
1189322874 X:40097098-40097120 TTCGCGGGGTACGCTGCGGGAGG + Intronic