ID: 950618081 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 3:14178421-14178443 |
Sequence | TTCGCGGGAGACGCCGCCGG TGG (reversed) |
Strand | - |
Crispr in exon? | Yes |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 44 | |||
Summary | {0: 1, 1: 0, 2: 1, 3: 4, 4: 38} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
950618081_950618092 | 22 | Left | 950618081 | 3:14178421-14178443 | CCACCGGCGGCGTCTCCCGCGAA | 0: 1 1: 0 2: 1 3: 4 4: 38 |
||
Right | 950618092 | 3:14178466-14178488 | CCTCCTCCTCCTCCTCACGCCGG | 0: 1 1: 1 2: 36 3: 207 4: 911 |
||||
950618081_950618093 | 23 | Left | 950618081 | 3:14178421-14178443 | CCACCGGCGGCGTCTCCCGCGAA | 0: 1 1: 0 2: 1 3: 4 4: 38 |
||
Right | 950618093 | 3:14178467-14178489 | CTCCTCCTCCTCCTCACGCCGGG | 0: 1 1: 2 2: 24 3: 128 4: 767 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
950618081 | Original CRISPR | TTCGCGGGAGACGCCGCCGG TGG (reversed) | Exonic | ||