ID: 950621203

View in Genome Browser
Species Human (GRCh38)
Location 3:14206971-14206993
Sequence GCCTTGAAACTGCTGGATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950621198_950621203 24 Left 950621198 3:14206924-14206946 CCAAACTGCTTTGGGTAGAAAGC No data
Right 950621203 3:14206971-14206993 GCCTTGAAACTGCTGGATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950621203 Original CRISPR GCCTTGAAACTGCTGGATGA AGG Intergenic
No off target data available for this crispr