ID: 950624922

View in Genome Browser
Species Human (GRCh38)
Location 3:14238278-14238300
Sequence GATGCCCAAAATGTTGGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950624922_950624929 20 Left 950624922 3:14238278-14238300 CCATCTCCAACATTTTGGGCATC No data
Right 950624929 3:14238321-14238343 ACGATTTTTCCACAGATGGTTGG No data
950624922_950624933 27 Left 950624922 3:14238278-14238300 CCATCTCCAACATTTTGGGCATC No data
Right 950624933 3:14238328-14238350 TTCCACAGATGGTTGGGTTGGGG No data
950624922_950624925 -6 Left 950624922 3:14238278-14238300 CCATCTCCAACATTTTGGGCATC No data
Right 950624925 3:14238295-14238317 GGCATCATGGACCCGTCTCATGG No data
950624922_950624930 21 Left 950624922 3:14238278-14238300 CCATCTCCAACATTTTGGGCATC No data
Right 950624930 3:14238322-14238344 CGATTTTTCCACAGATGGTTGGG No data
950624922_950624934 28 Left 950624922 3:14238278-14238300 CCATCTCCAACATTTTGGGCATC No data
Right 950624934 3:14238329-14238351 TCCACAGATGGTTGGGTTGGGGG No data
950624922_950624928 16 Left 950624922 3:14238278-14238300 CCATCTCCAACATTTTGGGCATC No data
Right 950624928 3:14238317-14238339 GAAGACGATTTTTCCACAGATGG 0: 8
1: 124
2: 248
3: 428
4: 514
950624922_950624931 25 Left 950624922 3:14238278-14238300 CCATCTCCAACATTTTGGGCATC No data
Right 950624931 3:14238326-14238348 TTTTCCACAGATGGTTGGGTTGG No data
950624922_950624932 26 Left 950624922 3:14238278-14238300 CCATCTCCAACATTTTGGGCATC No data
Right 950624932 3:14238327-14238349 TTTCCACAGATGGTTGGGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950624922 Original CRISPR GATGCCCAAAATGTTGGAGA TGG (reversed) Intergenic
No off target data available for this crispr