ID: 950624927

View in Genome Browser
Species Human (GRCh38)
Location 3:14238307-14238329
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950624927_950624936 3 Left 950624927 3:14238307-14238329 CCGTCTCATGGAAGACGATTTTT No data
Right 950624936 3:14238333-14238355 CAGATGGTTGGGTTGGGGGATGG No data
950624927_950624931 -4 Left 950624927 3:14238307-14238329 CCGTCTCATGGAAGACGATTTTT No data
Right 950624931 3:14238326-14238348 TTTTCCACAGATGGTTGGGTTGG No data
950624927_950624938 10 Left 950624927 3:14238307-14238329 CCGTCTCATGGAAGACGATTTTT No data
Right 950624938 3:14238340-14238362 TTGGGTTGGGGGATGGTTTAGGG No data
950624927_950624933 -2 Left 950624927 3:14238307-14238329 CCGTCTCATGGAAGACGATTTTT No data
Right 950624933 3:14238328-14238350 TTCCACAGATGGTTGGGTTGGGG No data
950624927_950624929 -9 Left 950624927 3:14238307-14238329 CCGTCTCATGGAAGACGATTTTT No data
Right 950624929 3:14238321-14238343 ACGATTTTTCCACAGATGGTTGG No data
950624927_950624937 9 Left 950624927 3:14238307-14238329 CCGTCTCATGGAAGACGATTTTT No data
Right 950624937 3:14238339-14238361 GTTGGGTTGGGGGATGGTTTAGG No data
950624927_950624934 -1 Left 950624927 3:14238307-14238329 CCGTCTCATGGAAGACGATTTTT No data
Right 950624934 3:14238329-14238351 TCCACAGATGGTTGGGTTGGGGG No data
950624927_950624930 -8 Left 950624927 3:14238307-14238329 CCGTCTCATGGAAGACGATTTTT No data
Right 950624930 3:14238322-14238344 CGATTTTTCCACAGATGGTTGGG No data
950624927_950624932 -3 Left 950624927 3:14238307-14238329 CCGTCTCATGGAAGACGATTTTT No data
Right 950624932 3:14238327-14238349 TTTCCACAGATGGTTGGGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950624927 Original CRISPR AAAAATCGTCTTCCATGAGA CGG (reversed) Intergenic
No off target data available for this crispr