ID: 950624928

View in Genome Browser
Species Human (GRCh38)
Location 3:14238317-14238339
Sequence GAAGACGATTTTTCCACAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1322
Summary {0: 8, 1: 124, 2: 248, 3: 428, 4: 514}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950624924_950624928 10 Left 950624924 3:14238284-14238306 CCAACATTTTGGGCATCATGGAC No data
Right 950624928 3:14238317-14238339 GAAGACGATTTTTCCACAGATGG 0: 8
1: 124
2: 248
3: 428
4: 514
950624922_950624928 16 Left 950624922 3:14238278-14238300 CCATCTCCAACATTTTGGGCATC No data
Right 950624928 3:14238317-14238339 GAAGACGATTTTTCCACAGATGG 0: 8
1: 124
2: 248
3: 428
4: 514

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950624928 Original CRISPR GAAGACGATTTTTCCACAGA TGG Intergenic
900466257 1:2826941-2826963 GCAGACGAATGTACCACAGAGGG - Intergenic
900950326 1:5854975-5854997 GAAGACGGAGTTTCCCCAGAAGG + Intergenic
901079089 1:6573576-6573598 GAAGACAATTTTTCTAAGGACGG + Intronic
901304539 1:8223168-8223190 GAAGACAATTTTTCCACAGCCGG - Intergenic
901516787 1:9753074-9753096 GAAGGCAATTTCTCCACAGATGG + Intronic
901581490 1:10247816-10247838 GAAGATAATTTTTCCACAGACGG + Intronic
902104190 1:14019845-14019867 GAAGACAATTTTTCCATGGATGG + Intergenic
902453787 1:16516778-16516800 GAAGACAATTTTTCCATGGAAGG + Intergenic
902473841 1:16669442-16669464 GAAGACAATTTTTCCATGGAAGG + Intergenic
902484962 1:16738000-16738022 GAAGACAATTTTTCCATGGAAGG - Intergenic
902498695 1:16893484-16893506 GAAGACAATTTTTCCATGGAAGG - Intronic
902600073 1:17534960-17534982 GAAGACAATTTTTCCATGGATGG + Intergenic
903043435 1:20549251-20549273 CAAGACAATTTTTCCATGGAGGG - Intergenic
903701929 1:25255551-25255573 GAAGACCATTTTTCCACAGCTGG + Intronic
904148224 1:28413068-28413090 GAAGACAATTTTTCTACAGACGG - Intronic
904203463 1:28836902-28836924 GAAGACAAGTTTTCCATCGATGG + Intronic
904353048 1:29921366-29921388 GAAGACAATTTTTCCACAGACGG + Intergenic
904564633 1:31421280-31421302 GAAGACACTTTTTCCACAGATGG - Intronic
904721925 1:32516688-32516710 GAAGACAATTTTTCCATTGAAGG - Intronic
905027041 1:34857786-34857808 GAAGACAATTTTTCCACAGATGG + Intronic
905095024 1:35462853-35462875 GAAGACAATTTTTCCATGAACGG + Intronic
905765429 1:40596241-40596263 GAAGACAATTTTTCCACGGATGG - Intergenic
905784613 1:40744247-40744269 CAAGACAATTTTTCCAGAGATGG - Intronic
905942057 1:41871605-41871627 GATGAACATGTTTCCACAGAGGG + Intronic
905998254 1:42401027-42401049 GAAGACGATTTTTCCACAGATGG + Intronic
906118906 1:43374493-43374515 GAAGACAATTTTTCCAAGGATGG + Intergenic
906440239 1:45836870-45836892 GAAGACAGTTTTTCCACAGATGG + Intronic
906825148 1:48971375-48971397 GAAGAGAATTTTTCCACTGGGGG - Intronic
906833911 1:49062168-49062190 GAAGACAGTTTTTCCATCGACGG - Intronic
907127370 1:52062807-52062829 GAAGACAGTTTTTCCACGGATGG + Intronic
907530571 1:55091389-55091411 GAAGACAATTTTTCCACAAAAGG - Intronic
907911219 1:58828335-58828357 GGAGACAATTTTTCCATAGATGG - Intergenic
908110129 1:60888477-60888499 GAAGACAATATTTCCACAGACGG + Intronic
908287822 1:62628051-62628073 GAAAAAAATTTTTCCACAGATGG + Intronic
908588722 1:65604887-65604909 GAAGACAATTTTTCCACTAATGG - Intronic
908611772 1:65868934-65868956 GAAGACAATTTTTCCACAGACGG - Intronic
908826144 1:68134510-68134532 GAAGAATGTTTTTTCACAGAGGG + Intronic
909278400 1:73718413-73718435 GAAGATAATTTTTCCACAGATGG - Intergenic
909329317 1:74393694-74393716 GAAGACAATTTTTCCACAGAAGG + Intronic
909423897 1:75499212-75499234 GAAGACAATTTTTCCATGGATGG + Intronic
909532996 1:76701758-76701780 GAAGACAATTTTTCCATGGATGG + Intergenic
909642378 1:77883195-77883217 GAAGACAATTTTTCCATGGACGG + Intergenic
909773795 1:79459000-79459022 GAAGACAATTTTTCTACGGCAGG - Intergenic
909941595 1:81617352-81617374 GAAGACATTTTTTCCATGGATGG - Intronic
910315236 1:85875054-85875076 GAAGACAGTTTTTCCACAGATGG - Intronic
910411937 1:86955463-86955485 GAAGACAATTTTTCCACAGGGGG - Intronic
910590268 1:88922653-88922675 GAAAACAATTTTTCCATGGATGG - Intergenic
910621479 1:89260066-89260088 GAAGGTAATTTTTCCACAGAGGG + Intronic
910686752 1:89925442-89925464 GAAGACAATTTTTCCATGGACGG - Intronic
910687273 1:89930085-89930107 GAAGACAATTTTTCCAGAAATGG - Intronic
910754933 1:90678929-90678951 GAAGACAATTTTTTCATGGATGG - Intergenic
910824967 1:91397080-91397102 GTGGACAGTTTTTCCACAGATGG - Intronic
910938353 1:92505622-92505644 GAAGAGGCTTTTTCAACGGAAGG + Intergenic
910953780 1:92679248-92679270 GAAGACCATTTCTCCACTTATGG - Intronic
910977138 1:92918750-92918772 GAAGACGGTTTTGCAACAGATGG + Intronic
911201250 1:95046492-95046514 GAAGACGGTTTTTCCACAGATGG - Intronic
911695119 1:100882107-100882129 GAAGACAATTTTTCCATGGATGG - Intronic
911894067 1:103406728-103406750 GAAGACAATTTTTTCATGGACGG - Intergenic
911978412 1:104533974-104533996 GAAGACAGTTTTTCCACATACGG + Intergenic
912339332 1:108895810-108895832 GAAGACAATTTTTCCATGGACGG - Intronic
913173559 1:116253966-116253988 GAAGATAATTTTTCCATGGATGG - Intergenic
913670590 1:121094390-121094412 GAAGGCAACTTTTCCACAGCCGG - Intronic
914005909 1:143732119-143732141 GAAGACAATTTTTCCATGGAAGG + Intergenic
914022356 1:143881829-143881851 GAAGGCAACTTTTCCACAGCCGG - Intergenic
914098379 1:144563362-144563384 GAAGACAATTTTTCCATGGAAGG + Intergenic
914300599 1:146374252-146374274 GAAGACAATTTTTCCATGGAAGG - Intergenic
914518086 1:148391142-148391164 GAAGACAGTTTTTCCATGGAAGG + Intergenic
914660839 1:149789770-149789792 GAAGGCAACTTTTCCACAGCCGG - Intronic
915590017 1:156865299-156865321 GAAGACAATTTTACCACGGATGG + Intronic
915962082 1:160275290-160275312 GAAGACAAGTTTTCCACAGAGGG - Intergenic
916149181 1:161769499-161769521 AAAGACAATTTTTCCACAGGAGG + Intronic
916874768 1:168957657-168957679 GAAGACAACTTTTCCACAGATGG + Intergenic
916952108 1:169790901-169790923 GAAGACAATTTTTCCATGAAGGG + Intronic
917031867 1:170701980-170702002 GAAGTCAATTTTTCCATGGATGG + Intronic
917614946 1:176733127-176733149 GAAGACAGTATTTCCACAGATGG - Intronic
917995921 1:180438235-180438257 GAAGACCATTTTTCTGCAGCAGG - Intronic
918428856 1:184437669-184437691 GAAGACAATTTTTCCATGAATGG + Intronic
918445664 1:184614548-184614570 GAAGACAATTTTTCCATGGATGG + Intronic
918502917 1:185217994-185218016 GAAGATAATTTTTCCATGGACGG - Intronic
918523996 1:185445095-185445117 GAAGACAATTTTTCCACAGATGG - Intergenic
918824729 1:189309709-189309731 GAAGACAATTTTTCCATGGGTGG + Intergenic
919007787 1:191921777-191921799 GAAGACAATTTTTCTATGGATGG - Intergenic
919515885 1:198522128-198522150 GAAGACAATTTTTCCAAGAATGG - Intergenic
919996563 1:202757045-202757067 GAAGGCAATTTTTCCATGGATGG + Intronic
920040849 1:203095424-203095446 GAGGAAGTTTTTTACACAGAAGG + Intronic
920580122 1:207098573-207098595 GAAGATGACTTTTCCACGGATGG + Intronic
921151865 1:212409146-212409168 GAAGACAATTTTTCCACAGATGG - Intronic
921245641 1:213236204-213236226 GAAGACAATTTTTCCGTGGATGG - Intronic
921377707 1:214491418-214491440 GAAGACAATCCTTCCACAAATGG + Intronic
921485307 1:215708519-215708541 GAAGACAATTTTTCCATGGAAGG + Intronic
921589910 1:216991199-216991221 GAAGATAATTTTTCCATGGATGG - Intronic
921731784 1:218586947-218586969 GAAGACAATTTTTTCATGGATGG + Intergenic
922010217 1:221575756-221575778 GAAGACAATTTTTCCATGGATGG - Intergenic
922781421 1:228256056-228256078 GAAGGCAATTTTTCCACAGATGG - Intronic
923027690 1:230219065-230219087 GAAGACAATTTTTCTACAGATGG - Intronic
923404339 1:233645323-233645345 AAGGACGTTTTTTCCAAAGAAGG - Intronic
923747021 1:236710900-236710922 GAAGACAATTTTTCCACGGGTGG - Intronic
924840003 1:247698682-247698704 GAAGACAATTTTTCCACAGGTGG + Intergenic
1063506113 10:6601227-6601249 GAAGATAATTTTTCCATGGATGG + Intergenic
1063594422 10:7420908-7420930 GAAGACAATTTTTCCATGGATGG - Intergenic
1063765981 10:9141050-9141072 GAAGACAATTTTTCCACAGAGGG + Intergenic
1063784279 10:9362880-9362902 GAAGATAATTTCTCCACGGATGG - Intergenic
1064178408 10:13095406-13095428 GAAGACAATTTTTCCATGGATGG + Intronic
1064269495 10:13852118-13852140 AAAGACAATTTTTCCACAGATGG - Intronic
1064310389 10:14207281-14207303 AAAGACAATTTTTCCACGGATGG + Intronic
1064339811 10:14475730-14475752 GAAGACAATTTTTCCATCGATGG - Intergenic
1064513458 10:16120604-16120626 GAAGGTAATTTTTCCACAGATGG - Intergenic
1064595275 10:16938216-16938238 GGAGTCCATATTTCCACAGAAGG + Intronic
1064744016 10:18461540-18461562 GAAGACTATTTTTCCACAGGTGG + Intronic
1064881966 10:20065474-20065496 AAAGGTGGTTTTTCCACAGAGGG + Intronic
1064962857 10:20985179-20985201 GAAGACAGTTTTTCCATGGATGG - Intronic
1065393347 10:25207426-25207448 GAAGACAATTTTTCCATCGATGG + Intronic
1065453028 10:25878564-25878586 GAAGACAATTTTTCCAGACAAGG - Intergenic
1065484999 10:26228822-26228844 GAAGACAATTTTTCCACATATGG - Intronic
1065931586 10:30483996-30484018 GAAGACAATTTTTCCATGAATGG - Intergenic
1065960238 10:30727996-30728018 GAAGACAATTTTTCCATGGATGG + Intergenic
1066352375 10:34648481-34648503 TAAGACAATTTTTCCACAAATGG + Intronic
1066397514 10:35040705-35040727 GAAGACAATTTTTCCACAGACGG + Intronic
1066677944 10:37908117-37908139 GAAGACAATTTTTCCAGACCAGG - Intergenic
1067092014 10:43271973-43271995 GAAGGCAATTTTTCCAGACAGGG + Intergenic
1067139271 10:43642850-43642872 AAAGACAATTTTCCCACAGAGGG - Intergenic
1067235573 10:44445689-44445711 GAGGACAAATTTTTCACAGATGG + Intergenic
1068036876 10:51770761-51770783 GAAGACAATTTTTCCACAAACGG - Intronic
1068063822 10:52103185-52103207 GAAGACAATTTTTCCATGAATGG - Intronic
1068415971 10:56723326-56723348 GAAGACAATTTTTCCATGGATGG - Intergenic
1068590494 10:58848071-58848093 GAACGCTATTTTGCCACAGAAGG - Intergenic
1068610654 10:59056585-59056607 GAAGACAAATTTTCCATGGACGG - Intergenic
1068748612 10:60565193-60565215 GAACACAATTTTTCCACAGATGG + Intronic
1068959224 10:62849886-62849908 GAAGACAATTTTTCCACAGATGG - Intronic
1069357266 10:67601256-67601278 GAATATAATTTTTCCACAGATGG + Intronic
1069605072 10:69733707-69733729 TAAGACAATTTTTCCATAGACGG - Intergenic
1069955145 10:72045559-72045581 TAAGAGGATTTTTCCTCAAAGGG + Intergenic
1070217884 10:74405711-74405733 GAAGACAATTTTTCCACGGACGG - Intronic
1071323989 10:84493711-84493733 GAAGACAACTTTTCCACAGATGG + Intronic
1071357877 10:84816732-84816754 GAAGACAATTTTTCCATAGATGG + Intergenic
1071850901 10:89569389-89569411 GAAGACAATTATTCCATGGATGG - Intergenic
1072015942 10:91346660-91346682 AAAGACAATTTTTCCACGGATGG - Intergenic
1072034835 10:91554167-91554189 GAAGACAATTTTTCCACGGATGG + Intergenic
1072056046 10:91756950-91756972 GAAGACAATTTTTCCACAGATGG + Intergenic
1072424531 10:95318792-95318814 GGAGACAATTTTTCCACAGATGG + Intronic
1072850413 10:98884684-98884706 GAAGACAATTTTTTCATGGATGG + Intronic
1072946715 10:99816886-99816908 GAAGACAATTTTTCCATAGATGG - Intronic
1073498497 10:103915790-103915812 GAAGACAATTTTTCCGGGGATGG + Intronic
1073587859 10:104727939-104727961 GAAGACAATTTTTCCATCGATGG - Intronic
1073610350 10:104937012-104937034 AAAGACAATTTTTCCACAGATGG + Intronic
1073682495 10:105719414-105719436 GAAGACAATTTTTCCACAGATGG + Intergenic
1073862783 10:107766611-107766633 GAAGACAATTTTTCCATGGATGG - Intergenic
1074124559 10:110517691-110517713 GAAGACAATTTTCCCACAGACGG - Intergenic
1074289761 10:112129601-112129623 GAAGACAATTTTTCTATGGACGG - Intergenic
1074637522 10:115337839-115337861 GAAGACAATTTTTCCACGGATGG + Intronic
1074663430 10:115690259-115690281 GAAGACAATTTTTCTACAGATGG + Intronic
1074925553 10:118066206-118066228 GAAGCAGATTTTTCCTCAGTCGG + Intergenic
1075246631 10:120828242-120828264 GCAGACTATTTTTCACCAGATGG - Intergenic
1075484618 10:122812189-122812211 GAAGACAAATTTTCCACAGATGG - Intergenic
1078229787 11:9429965-9429987 GAAGATAATTTTTCCACAGATGG + Intronic
1078330239 11:10413294-10413316 GAAGACAATTTTTCCAGGAATGG + Intronic
1078396630 11:10987406-10987428 GAAGACAATTTTTCCACAGATGG - Intergenic
1078849533 11:15151310-15151332 GAAGACAATTTTTCCATGCAGGG - Intronic
1079000644 11:16752274-16752296 GAAAACAATTTTTCCATGGAGGG - Intronic
1079405742 11:20144177-20144199 GAAGACAATTTTTCCATGGACGG + Intergenic
1079553593 11:21731905-21731927 GAAGACAATTTTTCCATGGATGG + Intergenic
1079785951 11:24673109-24673131 GAAGACAATTTTTCCATGGATGG - Intronic
1079814798 11:25042012-25042034 GAAGACAATTTTTCCATGAATGG - Intronic
1079896190 11:26121653-26121675 GAAGACAATTTTTCCACAGATGG + Intergenic
1080202102 11:29684203-29684225 GAAGACAATTTTTCTACAGAGGG + Intergenic
1080281563 11:30563238-30563260 AAAGACAGTTTTTCCACAGATGG + Intronic
1080350460 11:31379408-31379430 GAAAACAATTTTTCCATGGATGG - Intronic
1080470227 11:32538346-32538368 GAAGACAATTTTTCCATGGATGG + Intergenic
1080471547 11:32550745-32550767 GAAGACAATTTTTCCACCAATGG - Intergenic
1080722789 11:34866268-34866290 GAAGCCAATTTTCCCACAGATGG - Intronic
1080723655 11:34873292-34873314 GAAGACAATTTTTCCACAGATGG - Intronic
1080824219 11:35834313-35834335 GAAGACAATTTTTCCACAGATGG - Intergenic
1080884454 11:36353581-36353603 GGAAACAATTTTTCCACGGAGGG + Intronic
1082708838 11:56527908-56527930 GAAGACAATTTTTCCATGGATGG + Intergenic
1082841380 11:57692943-57692965 GGAGACACTTTTTCCACAGATGG + Intronic
1083489474 11:63005043-63005065 GTAGACAATTTTTCCATAGTAGG - Intronic
1084158912 11:67333860-67333882 GAAGACTTTTTTCCCATAGATGG - Intronic
1084768094 11:71325360-71325382 AAAGACCCTTTTTCCAAAGAGGG - Intergenic
1084994563 11:72963604-72963626 GAAGATAATTTTTCCACAGATGG + Intronic
1084997613 11:72997402-72997424 GAAGATGTTATTTCCAAAGAGGG - Intronic
1085587536 11:77724623-77724645 GAAGACAATTTTTCTATAGGAGG + Intronic
1086009724 11:82085902-82085924 GAAGACAATGTTTCCATAGACGG - Intergenic
1086155989 11:83666557-83666579 GAAGACAATGTTTCCACGGATGG - Intronic
1086462466 11:87019332-87019354 GAAGACAATTTTTCCATGAATGG + Intergenic
1086475793 11:87171769-87171791 GAAGACAATTTTTCCACGGGGGG + Intronic
1086489886 11:87348621-87348643 GGAGACCATTTTTCCATGGAGGG - Intergenic
1086801861 11:91185666-91185688 GAAGACAATTTTTCCAAGGAGGG + Intergenic
1087160392 11:94942880-94942902 GAAGACGATTTTTCCACAGATGG + Intergenic
1087583253 11:100085920-100085942 GAATAGGATTTTAACACAGAGGG + Intronic
1087584884 11:100106089-100106111 GAAGTCGGTTTTCCCACAAAGGG + Intronic
1087672048 11:101118967-101118989 GAATACAATTTTTCCATGGATGG + Intronic
1088917989 11:114241568-114241590 GAAGGCAATTTTTCCACGTATGG - Intronic
1089495217 11:118904775-118904797 GAAGAAACTTTTTCCAAAGAGGG - Intronic
1089512759 11:119010884-119010906 GAAGACGGTTTTTCCACAGATGG + Intronic
1089716170 11:120361416-120361438 GAAGACAATTTTTCCACAGATGG - Intronic
1090211206 11:124922227-124922249 GAAGAAAATTTTTCCATGGATGG - Intronic
1090230970 11:125103353-125103375 GAAGACAGTTTTTCCACAGGGGG - Intronic
1090912964 11:131137553-131137575 AAAGACTCTTTTTCCAAAGAAGG - Intergenic
1091212233 11:133871962-133871984 GAAGACAATTTTTCCATGGATGG - Intergenic
1091242430 11:134062855-134062877 GAAGACAAGCTTTCCACGGAAGG - Intergenic
1091536365 12:1413913-1413935 GAAGACAGTTTTTCCACAACGGG + Intronic
1091755330 12:3047619-3047641 TAAGACAATTTTTCCACGGATGG - Intergenic
1091792107 12:3277859-3277881 GAAGAACAATTTCCCACAGATGG - Intronic
1091956175 12:4645413-4645435 AAAGACAATTTTTCCACGGATGG + Intronic
1092554549 12:9543189-9543211 GAAGACAATTTTTCCACAGATGG + Intergenic
1092734297 12:11565533-11565555 AAAGACAATTTTCCCACGGATGG - Intergenic
1092820241 12:12347057-12347079 GAAGACAATTTTTCCATGGACGG + Intronic
1092892765 12:12984553-12984575 GAAGACAAATGATCCACAGATGG + Intronic
1093157887 12:15709805-15709827 GAAGACAATTTTTCCAAGGCAGG + Intronic
1093168768 12:15835739-15835761 GAAGACAGTTTTTCCATGGATGG - Intronic
1093251392 12:16808404-16808426 GAAGACAATTTTTCCATGGAGGG - Intergenic
1093260083 12:16925237-16925259 GAAGACAATTTTTCCATGGACGG + Intergenic
1093411894 12:18877595-18877617 GAAGACAATTTTTCCACAGATGG + Intergenic
1093953812 12:25194141-25194163 AAATACGAGTTTTCCACATATGG - Intronic
1094053885 12:26249078-26249100 GAAGACAGTTTTTCCATGGAGGG + Intronic
1094488118 12:30941013-30941035 GAAGACAATTTTTCCACGGATGG - Intronic
1094517550 12:31147446-31147468 GAAGACAATTTTTCCACAGATGG - Intergenic
1094719090 12:33044230-33044252 GAAGATGATTTTTCCACGGATGG + Intergenic
1095145902 12:38725927-38725949 GAAGACAGTTTCCCCACAGATGG + Intronic
1095184059 12:39180418-39180440 GAAGACAATTTTTCCATGGATGG + Intergenic
1095184375 12:39184729-39184751 GAAGACAATTTTTTCACGGATGG - Intergenic
1095203042 12:39408164-39408186 GAAGACAGTTTTTCCAGGGATGG + Intronic
1095390061 12:41695336-41695358 GAAGACAATTTTTTCATGGATGG - Intergenic
1095393972 12:41742028-41742050 GAAGAAAATTTTTCCACAGATGG + Intergenic
1095574059 12:43714224-43714246 GATGACAATTTTTCCATGGACGG - Intergenic
1095869705 12:47012874-47012896 AAAGACTATTTTTCCAAATAAGG + Intergenic
1095914802 12:47467010-47467032 GAAGACAATTTTTCCATGGATGG + Intergenic
1096019236 12:48308324-48308346 GAAGACAATTCTTCCATGGACGG + Intergenic
1096125568 12:49116955-49116977 GAAGACAATTTTTCCATGAATGG - Intergenic
1097050129 12:56217880-56217902 GAAGATAGTTTTTCCACAGATGG - Intronic
1097110567 12:56655008-56655030 GAAGACAATTTTTCCATGGATGG - Intergenic
1097408284 12:59218923-59218945 GAAGAAGATTCTTCCCCAGTTGG - Intergenic
1097549558 12:61049906-61049928 GAAGATAATTTTTCCACAGATGG - Intergenic
1097637995 12:62145456-62145478 GAAGACAATTTTTCCACGGACGG - Intronic
1098140462 12:67445439-67445461 GAAGACAATTTTTCCACTGATGG + Intergenic
1098157298 12:67612816-67612838 GAAGACAATTTTTCCATGGATGG - Intergenic
1098846988 12:75549935-75549957 GAAAACAATTTTTCCAGTGAGGG + Intergenic
1099703954 12:86126854-86126876 GAAGACAATTTTTCAATGGACGG + Intronic
1099810080 12:87569327-87569349 GAAGACAGTTTTTCCATGGATGG - Intergenic
1099863535 12:88249356-88249378 GAAGACAATTTTTCCACAGACGG - Intergenic
1100017294 12:90026039-90026061 AGAGAAGATTTTTCCACAGATGG - Intergenic
1100162161 12:91872949-91872971 GAAGACAATTTTTCCATGGATGG - Intergenic
1100341558 12:93684248-93684270 GAAGACAATTTTTCAACCAACGG + Intronic
1100386728 12:94110653-94110675 GAAGACAGTTTTTCCACAAATGG - Intergenic
1100553675 12:95671633-95671655 GAAGACAATTTTTCCATGGATGG - Intronic
1100567270 12:95809359-95809381 GAAGACAATTTTTCCATGGACGG + Intronic
1100852649 12:98729279-98729301 GAAGACAATTTTTCCACAGATGG + Intronic
1100993680 12:100279142-100279164 GAAGACAGTTTTTCCACAGATGG + Intronic
1101373427 12:104150950-104150972 GAAGACAATTTTTCCACGGATGG - Intergenic
1101375567 12:104168420-104168442 GAAGATAATTCTTCCACAGATGG - Intergenic
1101635532 12:106537614-106537636 GAAGACAATTTTTCCATAGATGG - Intronic
1101861121 12:108483263-108483285 GAAGACAATTTTTCCACGGACGG - Intergenic
1101917178 12:108904634-108904656 GAAGACAATTTTTCCACAGATGG - Intergenic
1101931460 12:109017369-109017391 GAAGACAATTTTTCCATGGATGG - Intronic
1101976744 12:109366088-109366110 GAAGACAATTTTTCCATGGACGG - Intronic
1102114962 12:110395922-110395944 AAAGACAATTTTTCCACAGATGG + Intronic
1102338583 12:112103751-112103773 AAAGACAATTTTTCCACAGATGG + Intronic
1102446042 12:113003514-113003536 GAAGACCCTTTTTCCAAATAAGG + Intronic
1103226378 12:119291527-119291549 GAAGACAATTTTTCCACAGACGG - Intergenic
1103865390 12:124047748-124047770 GAAGACAGTTTTTCTGCAGATGG - Intronic
1104176058 12:126333773-126333795 GAAGATAATTTTTCCATGGATGG - Intergenic
1104418468 12:128615266-128615288 GAAGACAATTTTTCCACAGATGG + Intronic
1104501819 12:129293439-129293461 GAAGACAATTTTTCCAAAGACGG + Intronic
1104708751 12:130969736-130969758 GAAGACAATTTTTCCATGGATGG - Intronic
1104722186 12:131050730-131050752 GAAGACAATTTTTGCACGGATGG + Intronic
1105064285 12:133183169-133183191 GAGGACAATTTTTCCATGGACGG - Intronic
1105328413 13:19391356-19391378 GAAGGCAATTTTTCCATGGACGG - Intergenic
1105500850 13:20970501-20970523 GAAGACAATTTTTCCATGGACGG + Intergenic
1105570579 13:21599126-21599148 GAAGACAGTTTCTCCACTGATGG - Intronic
1105726855 13:23171616-23171638 AAAGACAGTTTTTCCATAGATGG + Intergenic
1106007044 13:25780653-25780675 GAAGACAGTTTTTCCACAGAGGG + Intronic
1106457190 13:29937677-29937699 GAAGACAATTTTTCCACAGATGG - Intergenic
1106474315 13:30084308-30084330 GAAAGCAATTTTTCCACAGATGG - Intergenic
1107106360 13:36647583-36647605 GAAGACATTTTTTCTGCAGACGG + Intergenic
1107506587 13:41040496-41040518 GAAGACAATTTTTTCACGGATGG + Intronic
1107749539 13:43549951-43549973 GATGACAATTTTTCCACAGATGG + Intronic
1107874437 13:44777699-44777721 GAAGATAATTTTTCCAGGGATGG + Intergenic
1108015820 13:46074735-46074757 GAAGACAATTTTTCCATGGATGG + Intronic
1108119757 13:47171987-47172009 GAAGACAATTTTTCCATGGAAGG + Intergenic
1108125821 13:47241408-47241430 GAAGATAATTCTTCCACAGATGG + Intergenic
1108320100 13:49281402-49281424 GAAGACAATTTTTCCACAGATGG + Intronic
1108346858 13:49554786-49554808 GAAGACAGTTTTTCCACAGATGG - Intronic
1108461299 13:50670100-50670122 GAAAACAATTTTTCTACAGATGG + Intronic
1108487134 13:50938529-50938551 GAAGACAATTTTTCCATGGATGG + Intronic
1108820435 13:54342710-54342732 GAAGACAATTTGTCCATGGATGG - Intergenic
1108826183 13:54415420-54415442 GAAGACAATATTTCCATGGATGG - Intergenic
1108845181 13:54669610-54669632 GAAGACAATTTTTCCATGGATGG - Intergenic
1108849488 13:54710265-54710287 GAAGACAATTTTTTCACAGTTGG + Intergenic
1109240767 13:59884412-59884434 GAAGACACTTTTTTCATAGATGG - Intronic
1109346741 13:61124297-61124319 GAAGACAATTTTTTCACAGACGG - Intergenic
1109818774 13:67623692-67623714 TAAGACAATTTTCCCTCAGACGG - Intergenic
1109882871 13:68504469-68504491 GAAGACAATTTTTCCACGGATGG + Intergenic
1109990475 13:70048552-70048574 GAAAGCAATTTTTCCACAGATGG + Intronic
1110077674 13:71269453-71269475 GAAGACAATTTTTCCATGGATGG + Intergenic
1110105466 13:71669577-71669599 GAAGACATTTTTTCCACTGATGG - Intronic
1110107439 13:71695370-71695392 GAAGACGACTTTTGGAGAGAGGG - Intronic
1110232523 13:73181878-73181900 GGAGACAATTTTTCCACAGATGG + Intergenic
1110330916 13:74271205-74271227 GAAGACAATTTTTCCACAGATGG - Intergenic
1110399946 13:75078510-75078532 GAGGAGGATTTTTACACAGATGG - Intergenic
1110471394 13:75863904-75863926 GAAGACAATTTTTCCACAGACGG - Intergenic
1110477079 13:75928617-75928639 GAAAACAATTTTTCCATAGATGG - Intergenic
1110604288 13:77412987-77413009 GAATATAATTTTTTCACAGATGG - Intergenic
1110745076 13:79043073-79043095 GAAGACAATTTCTCCAAAGACGG + Intergenic
1110849967 13:80233691-80233713 GAAGACAATTTTTCCATGAATGG + Intergenic
1111046419 13:82819776-82819798 GAAGACAATTTTTCCTTGGATGG - Intergenic
1111070641 13:83161362-83161384 GAAGACAATTTTTCCATGGGAGG - Intergenic
1111320963 13:86628352-86628374 GAAGACAATTTTTCCATGGATGG + Intergenic
1111347050 13:86972616-86972638 GAAGACAATTTTTCCATGGATGG + Intergenic
1111989771 13:95104921-95104943 GAGGACAATTTTTCCATGGATGG + Intronic
1112032945 13:95473982-95474004 GAAGACAGTTTTTCCACGGACGG + Intronic
1112353913 13:98658997-98659019 GAAGACAATTTTTCCATGGCGGG + Intergenic
1112410273 13:99156904-99156926 GAAGATAATTCTTCCACAGACGG + Intergenic
1112487225 13:99830865-99830887 AAAGACCATTTTTCCAAATAAGG - Intronic
1112514948 13:100045306-100045328 GGAGACGATTTTTCCATGGATGG + Intergenic
1112581394 13:100679190-100679212 GAAGACAATTTTTCCATGGATGG - Intergenic
1112594444 13:100795120-100795142 GAAGACAATTTTTCCATGGATGG - Intergenic
1113626699 13:111853117-111853139 GAAGACAATTTCTCCACAGATGG - Intergenic
1113658346 13:112085559-112085581 GGAGACAAACTTTCCACAGATGG + Intergenic
1114576608 14:23719996-23720018 GAAGACAATTTTTCCACAGATGG - Intergenic
1114824594 14:26061856-26061878 GAAGACACATTTTCCCCAGAAGG + Intergenic
1114897141 14:27005027-27005049 GAAGACAATTTTTCCACGGATGG - Intergenic
1115053300 14:29091395-29091417 GAAGACAATATTTCCACAGCTGG - Intergenic
1115292265 14:31785531-31785553 GAAGACAATTTTTCCATGGATGG - Intronic
1115327112 14:32152209-32152231 GAAGACAGTTTTTCCACAGATGG - Intronic
1116087760 14:40263156-40263178 GAAGACAATTTTTTCACAGATGG + Intergenic
1116760427 14:49006363-49006385 AAAGACTCTTTTTCCTCAGAAGG + Intergenic
1116843608 14:49844173-49844195 GAAGACAATTTTTCCATGGATGG + Intronic
1117088807 14:52228778-52228800 GAAGACAATTTTTCCACGGAAGG + Intergenic
1117138810 14:52765651-52765673 AAAGACAATTTTTCCACGGATGG + Intronic
1117432227 14:55678900-55678922 GAAGACAATTTTTCCACAGATGG - Intronic
1117559125 14:56917923-56917945 GAAGACAATTTTTCCATATATGG + Intergenic
1117609581 14:57468345-57468367 AAAGACAATTTTTCCACAGATGG - Intergenic
1117717252 14:58593972-58593994 GTAGACAATTTTTCCACAGCTGG - Intergenic
1118385437 14:65252068-65252090 AAAGACAATTTTTCCATGGAAGG - Intergenic
1118472555 14:66088437-66088459 GAAGATGATTTTTATACAAATGG - Intergenic
1118513829 14:66505876-66505898 GAAGACAATTTTTCCATGGATGG - Intergenic
1118676043 14:68185648-68185670 GAAGACAATTTTTCCGTGGATGG + Intronic
1118943042 14:70356181-70356203 GCAGACCATTTTTCCACAGATGG + Intronic
1119072598 14:71602899-71602921 GAAGACAATTTTTCCATGGATGG - Intronic
1119454432 14:74742507-74742529 GAAGACAGTTTTTCCACAGATGG + Intergenic
1119907312 14:78317545-78317567 GAAGATACTTTTTCCACAGATGG - Intronic
1120311195 14:82830595-82830617 GAAGACAATGTTTCCATGGATGG + Intergenic
1120347360 14:83307939-83307961 GAAAACAATTTTTCTACAAACGG + Intergenic
1120428431 14:84381354-84381376 GAAGACAATTTTTCCACGGATGG + Intergenic
1120606137 14:86580894-86580916 GGAGACAATTTTAGCACAGAGGG + Intergenic
1120618787 14:86737568-86737590 GAAGACAATTTATCCATGGATGG - Intergenic
1120810972 14:88803145-88803167 GAAGACAATTTTTCCACGGATGG - Intergenic
1120988529 14:90354957-90354979 GAAGACAATTTTTCCACGGATGG + Intergenic
1121539796 14:94716944-94716966 GAAGACAATTTTTCCACGGATGG - Intergenic
1121843789 14:97155862-97155884 GAAGCAGAATTTGCCACAGATGG - Intergenic
1122143998 14:99677989-99678011 TAAGACAATTTTTCCATGGATGG + Exonic
1122472771 14:101982681-101982703 GAAGACGATTTTTCCACAGATGG - Intronic
1122584478 14:102795748-102795770 GAAGACCCTTATTCCAGAGAGGG + Intronic
1123009396 14:105340433-105340455 GAAGACAGTTTTTCCACAGACGG + Intronic
1202890641 14_KI270722v1_random:154021-154043 GAAGACAATTTTTCCACAGATGG - Intergenic
1123922755 15:25082043-25082065 GAAGACAAGCATTCCACAGAGGG - Intergenic
1124574112 15:30892655-30892677 GGAAACGATTTTTCCACAGATGG - Intergenic
1124788466 15:32703868-32703890 GAAGACAATTTTTCCGTGGATGG - Intergenic
1124817133 15:33005349-33005371 GCAGATGATTTTTTTACAGATGG + Intronic
1124864459 15:33475356-33475378 GAAGAGAGTTTTTCCACGGATGG + Intronic
1124866443 15:33496732-33496754 GAAGACGATTTATTCATATATGG - Intronic
1125468382 15:39977240-39977262 GAAGACAATTTTTCCACAGACGG + Intronic
1125499711 15:40232021-40232043 AAAGACAGTTTTTCCACAGATGG + Intergenic
1125752535 15:42038259-42038281 GAAGACAATTTTTCCATGGATGG + Intronic
1125809393 15:42524624-42524646 GAAGACTATTTTTCCACGAATGG - Intronic
1125835536 15:42747440-42747462 GAAGACAATTTTTCCACGATGGG + Intronic
1125949691 15:43741534-43741556 GAAGACAGTTTTTCCATGGATGG - Intergenic
1125993312 15:44131861-44131883 GAAGTCAATTTTTCCACAGGTGG + Intronic
1126136185 15:45394348-45394370 GAAGACAATTTTTGCACAGATGG - Intronic
1126142884 15:45451972-45451994 GAAGACAATTTTTCCACTGATGG - Intergenic
1126474909 15:49055194-49055216 GAAGACAATTTTTCCATGGATGG - Intergenic
1126489912 15:49225560-49225582 GAAGACAATTTTTCCATGGATGG - Intronic
1127159327 15:56164971-56164993 GAAGACAATTTTTCCATGGATGG + Intronic
1127219809 15:56867246-56867268 GAAGACAATTTTTCCACAGATGG + Intronic
1127550826 15:60036790-60036812 GAAGACAATTTTTCTACGGATGG + Intronic
1127663286 15:61120375-61120397 GAAGACCATTGTTCCAAAGGAGG + Intronic
1127715548 15:61645681-61645703 AAAGACTCTTTTTCCAGAGAAGG - Intergenic
1128175991 15:65556111-65556133 GAAGGCACTTTTTCCACAGATGG + Intronic
1128520161 15:68369854-68369876 AAAGACACTTTTTCCAAAGAAGG - Intronic
1128652996 15:69433632-69433654 GAAGACAATTTTTACACAGATGG - Intronic
1128662765 15:69514215-69514237 GAAGACAATTTTTCCACGGACGG - Intergenic
1128746036 15:70114796-70114818 GGAGATAATTTTTCCACGGACGG - Intergenic
1128934926 15:71738119-71738141 GAAGACGATTTCTCCATGGATGG + Intronic
1128964961 15:72049819-72049841 GATGAAAATTTTTCCACAGATGG - Intronic
1129018421 15:72490560-72490582 GAAGACAATTTTTCCATGAAAGG - Intronic
1129218100 15:74113005-74113027 GAAGACAATTTTTCTACAGACGG + Intronic
1129406260 15:75320572-75320594 GAAGACAATTTTTCCACAGACGG - Intergenic
1129735212 15:77957047-77957069 GAAGACAATTTTTCCACAGACGG + Intergenic
1129998252 15:80025463-80025485 GAAGACAATTTTTCCAGGGATGG - Intergenic
1130760492 15:86814334-86814356 GAAGATGATGTTTCCACAGATGG - Intronic
1130781070 15:87041882-87041904 AAAGACAATTTTTCCATGGATGG - Intergenic
1130918860 15:88327327-88327349 GAAGACAATTTTTCCATGGATGG + Intergenic
1131080348 15:89529293-89529315 GAAGACAATTTTTCCATGGAGGG - Intergenic
1131158996 15:90092243-90092265 GAAGACAATTTTTCCACGGGTGG - Intronic
1131407297 15:92175828-92175850 GAAGACAATTTTTCCATGGATGG - Intergenic
1131613988 15:93994479-93994501 GAAGAAAATTGTTCCACAGAAGG - Intergenic
1132032122 15:98446859-98446881 GAAGACAGTTTTTCCACGGATGG - Intronic
1132076521 15:98825639-98825661 GAAGACAATTTTTCCACAGATGG - Intronic
1132164680 15:99574322-99574344 GAAGACAATTTTTCCATGAATGG + Intronic
1132378988 15:101352991-101353013 GAAGACAATTCTTCCACAGCTGG + Intronic
1133650389 16:7807186-7807208 GAAGACAGTTTTTCCACCCATGG - Intergenic
1133809134 16:9147724-9147746 GAAGACAATTTTTCCACGGACGG + Intergenic
1133866744 16:9651162-9651184 GAAGACCCTATTTCCAAAGAAGG - Intergenic
1133975772 16:10599014-10599036 GAAGATGACAGTTCCACAGAGGG + Intergenic
1133977315 16:10608499-10608521 GGAGGCAATTTTTCCACAGATGG - Intergenic
1134256649 16:12617843-12617865 GAGGACAGTTTTTCCACAGATGG - Intergenic
1134393836 16:13844110-13844132 GAAGACAATTTTTCCACGAATGG + Intergenic
1134583476 16:15391332-15391354 GAAGACAATTTTTCCACAGGCGG - Intergenic
1134787306 16:16956319-16956341 GAAGACAATTTTTCCATGCATGG - Intergenic
1135191400 16:20357721-20357743 GAAGACAATTTTTCCAGGGATGG + Intergenic
1135314966 16:21436767-21436789 GAAGACAATTTTTCCACAGGCGG - Intronic
1135367892 16:21869035-21869057 GAAGACAATTTTTCCACAGGCGG - Intronic
1135443925 16:22502114-22502136 GAAGACAATTTTTCCACAGGCGG + Intronic
1135449440 16:22544714-22544736 GAAGACAATTTTTCCACAGGCGG + Intergenic
1135615395 16:23907212-23907234 GAAGATGATTTTGCCACCCAGGG - Intronic
1135693518 16:24565660-24565682 GAAGACAATTTTTCCATGGACGG - Intronic
1135798721 16:25472460-25472482 GAAGACAATTTTTCCATGGATGG - Intergenic
1135839497 16:25861998-25862020 GAAGACAGTTTTTCCATGGATGG + Intronic
1136192803 16:28628030-28628052 GAAGACAATTTTTCCACAGGCGG + Intergenic
1136311636 16:29415428-29415450 GAAGACAATTTTTCCACAGGCGG - Intergenic
1136325079 16:29517223-29517245 GAAGACAATTTTTCCACAGGCGG - Intergenic
1136390165 16:29959112-29959134 GAAGACAATTTTTCCACCAGGGG + Intronic
1136439764 16:30257207-30257229 GAAGACAATTTTTCCACAGGCGG - Intergenic
1136674286 16:31886570-31886592 GAAAACAATTTTTCCATGGATGG - Intronic
1137332389 16:47511864-47511886 GAAAACAAGTTTTCCACGGATGG + Intronic
1137714189 16:50587975-50587997 GAAGACAATTTTTCCATGGATGG - Intronic
1138257653 16:55580959-55580981 GAAGACAATTTTTCCATGGATGG - Intronic
1138313742 16:56050506-56050528 GAAGACAATTTTTCCACAGATGG - Intergenic
1138480195 16:57297615-57297637 GAAGACTATTTTTCCAGAGGAGG + Intergenic
1139149564 16:64364923-64364945 CACCACAATTTTTCCACAGATGG - Intergenic
1139307333 16:65998359-65998381 GAAGACAATTTTTCCATGGATGG + Intergenic
1139733396 16:68967184-68967206 GAAGACAATATTTCCATGGACGG + Intronic
1139764629 16:69216792-69216814 GAATACTATTTTTCAAAAGAAGG - Intronic
1139859162 16:70006471-70006493 GAAGACAGTTTTTCCACAGGCGG - Intergenic
1139886266 16:70209504-70209526 GAAGACAATTTTTCCACAGGCGG - Intergenic
1140163294 16:72522338-72522360 GAAGACAATTTTTCCACACATGG + Intergenic
1140239259 16:73186252-73186274 GAAGGCAGTTTTTCCACAGATGG - Intergenic
1140330901 16:74055859-74055881 GAAGACCCTTTTTCCAAATAAGG + Intergenic
1140606619 16:76546693-76546715 GAAGACAGGTTTTCTACAGATGG - Intronic
1140794228 16:78421511-78421533 GAAGACCCTTTTTCCAAATAAGG + Intronic
1140919711 16:79526205-79526227 GAAGACAATTTTTCCATGGATGG + Intergenic
1141043607 16:80694071-80694093 GAAGACAATTTTTCCACGACGGG + Intronic
1141107138 16:81242953-81242975 GAAGATAATTTTTCCATGGATGG - Intronic
1141120047 16:81346627-81346649 GAAGACAATCTTTCCACAGAAGG - Intronic
1141194952 16:81853446-81853468 GAAGACAGTTTTTCCACAGATGG + Intronic
1141230982 16:82167405-82167427 GAAGACAATTTTTCCACGGGTGG + Intronic
1141320292 16:83002155-83002177 AAAGACCCTTTTTCCAAAGAAGG - Intronic
1141386196 16:83624401-83624423 GAACACAATTTTTTCACAGATGG + Intronic
1141772499 16:86099159-86099181 GAAGACAACTTTTCCATGGACGG + Intergenic
1141929707 16:87193987-87194009 GAAGACAGTTTTTCCATGGATGG + Intronic
1142015124 16:87741566-87741588 GAAGACAGTTTTTCCACCGCTGG - Intronic
1142031723 16:87841875-87841897 GAAGACCCTTTTTCCAAATAAGG + Intronic
1142435081 16:90051513-90051535 GAAGACAATTTTTCCACAGATGG - Intergenic
1142534834 17:606881-606903 GAAGACAGTTTTTCCAGAGGTGG - Intronic
1142794452 17:2296651-2296673 GAAGACAGTTTTTCCATGGACGG - Intronic
1142943507 17:3403885-3403907 GAAGACTAGTCTTCCACAAATGG - Intergenic
1143066070 17:4248427-4248449 GAAGACAGTTTGTCCATAGATGG - Intronic
1143279476 17:5741802-5741824 GAAGACAATTTTTCCACGGACGG + Intergenic
1143727671 17:8860496-8860518 GAAGGCAATTTTTCCACGGAAGG - Intronic
1143832960 17:9666993-9667015 TAAGAGGATGATTCCACAGAAGG + Intronic
1144450140 17:15370380-15370402 GAAGACAATTTTTCCACGAATGG + Intergenic
1144614076 17:16752326-16752348 GAAAACAATTTTTCCACAGACGG - Intronic
1144865315 17:18331816-18331838 GAAGACAGTTTTTTCACGGATGG + Intronic
1144898634 17:18563341-18563363 GAAAACAATTTTTCCACAGACGG + Intergenic
1145133742 17:20382378-20382400 GAAAACAATTTTTCCACAGACGG - Intergenic
1146307189 17:31739387-31739409 TAAGATGTTTTTTCCCCAGAAGG + Intergenic
1146738122 17:35257108-35257130 GAAGACAATTTTTTCACGGATGG - Intronic
1147012421 17:37461077-37461099 GAAGACTGTTTTTCCATGGATGG + Intronic
1147173576 17:38636449-38636471 GAAGACAGTTTTTCCACAGATGG - Intergenic
1147412402 17:40263188-40263210 GAAGACAATTTTTCCATAGATGG + Intronic
1148845105 17:50525307-50525329 GAAGACAATTTTTCCACGGATGG - Intronic
1149222208 17:54428344-54428366 GTATATGTTTTTTCCACAGAAGG + Intergenic
1149270962 17:54976824-54976846 GAAGACAATTTTTCCACGCATGG - Intronic
1149272096 17:54990662-54990684 GAAGACAATTTTTCCAAGGTGGG - Intronic
1149656846 17:58314343-58314365 AAAGACGCTTTTTCCAAATAAGG - Intronic
1149946545 17:60933860-60933882 GAAGAGGATGTTTCCATAGTAGG + Intronic
1151506097 17:74528252-74528274 GAAGACAATTTTTCCACATCAGG - Intronic
1151573727 17:74940727-74940749 GAAGACAATTTTTCCATGGATGG - Intronic
1151836706 17:76586641-76586663 GAAGACAATTTTTCCACGGAGGG + Intronic
1152990363 18:358128-358150 GAAGATAATTTTTCCATGGATGG - Intronic
1153021697 18:635211-635233 GAAGACAATTTTTCCAAAGATGG + Intronic
1153205610 18:2696519-2696541 GAAGACAATTTTTCCAGAGATGG - Intronic
1153386629 18:4504912-4504934 AAAGACAGTTTTTCCACAGATGG - Intergenic
1153406598 18:4747796-4747818 GAAGACAATTTTTCCACAGATGG - Intergenic
1153479728 18:5535195-5535217 GAAGACAGTTTTTCCATGGACGG - Intronic
1153693316 18:7615678-7615700 GAAGACAATTTTTCCACAGATGG + Intronic
1153912207 18:9714232-9714254 GAAGACGATTTTTCCACAGATGG + Intronic
1154045632 18:10902209-10902231 GAAGACAATTTTTCCACGGATGG - Intronic
1154236235 18:12608948-12608970 GAAGACAATTTTTCCACAAATGG + Intronic
1155320187 18:24611477-24611499 GAAGACAATTTTTCCATGGATGG - Intergenic
1155459964 18:26067844-26067866 GAAGGCAATTTTTCCACTGATGG + Intronic
1155887321 18:31224000-31224022 GAAGATGGTTTTTCCATGGATGG - Intergenic
1155908297 18:31478788-31478810 GAAGACAATTTTTCCACAGACGG + Intergenic
1156151985 18:34253489-34253511 GAAGACATTTCTTCCACAGATGG - Intergenic
1156315093 18:35962247-35962269 GAAGACAGTTTTTCCACAGATGG - Intergenic
1156475069 18:37400836-37400858 AAATCCGAGTTTTCCACAGATGG + Intronic
1156774659 18:40772365-40772387 GAAGACCATTTTTCCATGGATGG + Intergenic
1157375620 18:47161681-47161703 GAAGACAATTTTTCCACAGATGG + Intronic
1157513853 18:48297047-48297069 GAAGACAAATTTTCCACAGACGG - Intronic
1157986889 18:52448289-52448311 GAAGACAATTTTTCCACAGAGGG - Intronic
1158177497 18:54673787-54673809 GAAGACAAATTTTCCACTGATGG - Intergenic
1158499771 18:57989903-57989925 GAAGACGATTTTTCCACCGATGG + Intergenic
1158568328 18:58574692-58574714 GAAGACAATTTTTCCACAGCCGG - Intronic
1158584401 18:58718587-58718609 GAAGACAATTTTTCCATGGACGG - Intronic
1158910548 18:62057020-62057042 GAAGACAGTTTTTCCACGGATGG - Intronic
1158940898 18:62405291-62405313 GGAGACAATTTTTCCACAGATGG + Intergenic
1159021768 18:63149183-63149205 GAGGACAATTTTTCCACGAATGG + Intronic
1159031127 18:63233454-63233476 GAAGACAGTTTTTCCATAGACGG + Intronic
1159256522 18:65954374-65954396 GAAGACAGTTTTTCCATGGACGG + Intergenic
1159299330 18:66542903-66542925 GAAGACAATTTTTCCAAGGTCGG - Intronic
1159324590 18:66897870-66897892 GAAGACAATTTTTCCACAGATGG - Intergenic
1159437441 18:68437552-68437574 GAAGACAACTTTTTCAGAGATGG + Intergenic
1159647570 18:70936949-70936971 GAAGACACTTTTTCCACAAATGG - Intergenic
1159807620 18:72975024-72975046 AAAGACAAATTTTCCACTGATGG + Intergenic
1159944337 18:74432675-74432697 GAAGACAATTTTTCCACAGATGG - Intergenic
1160172692 18:76567921-76567943 AAAGATGCTATTTCCACAGAAGG + Intergenic
1160192519 18:76725802-76725824 GAAGACAGTTTTTCCACAGATGG + Intergenic
1160223194 18:76992190-76992212 GAAGACAGTTTTTCCATGGATGG + Intronic
1160245777 18:77158423-77158445 GAAGACAATTTTTCCATGGATGG + Intergenic
1160369092 18:78356443-78356465 GAAGACAGTTTTTCCACAGTCGG + Intergenic
1161271990 19:3394908-3394930 GAAGACAATTTTTCCAGGGACGG - Intronic
1161976282 19:7609566-7609588 GAAGACAATTTTTCCACAGATGG + Intronic
1162218067 19:9152795-9152817 GAAGACAATTTTTCCATGGATGG - Intronic
1162943095 19:14025886-14025908 GAAGACAATTTTTCCATGGATGG - Intergenic
1163384174 19:16989211-16989233 GAAGACAATTTTTCCACAGACGG - Intronic
1163642964 19:18472264-18472286 GAAGACAATTTTTCTATGGATGG + Intronic
1163644620 19:18481601-18481623 AAAGTCCCTTTTTCCACAGAAGG + Intronic
1163687884 19:18722389-18722411 AAAGACCTTTTTTCCACATAAGG - Intronic
1164272120 19:23682322-23682344 GCAGACTTTTTTTCCACAGAGGG - Intronic
1164494603 19:28748445-28748467 GAAGAAAATTTTTCCACATATGG - Intergenic
1164632626 19:29771616-29771638 AAAGACGCTATTTCCACATAAGG - Intergenic
1164794043 19:31012087-31012109 GAGGACAGTTTTTCAACAGATGG - Intergenic
1164945091 19:32286705-32286727 AAAGACAATTTTTCCACTGATGG + Intergenic
1165053637 19:33159732-33159754 GAAGACAACTTTTCCACAAATGG + Intronic
1165124512 19:33584117-33584139 GAAGACAATTTTTCCGTGGATGG + Intergenic
1165479247 19:36052421-36052443 GAAGACAGTTTTTCCACGGATGG - Intronic
1165506949 19:36239063-36239085 GAAGACAATTTTTCCACGGACGG - Intronic
1165988545 19:39792080-39792102 GAAGAAAATTTTTCCACAGACGG + Intergenic
1166612891 19:44215075-44215097 GAAGATAATTTTTCCACGGATGG - Intronic
1167170952 19:47831565-47831587 GAAGATAATTTTTCCATGGATGG - Intronic
1167986805 19:53325261-53325283 GAAGACAGTTTTTCCATGGATGG - Intergenic
1167998641 19:53426778-53426800 GAAGGCAGTTTTTCCACAGATGG - Intronic
1168008765 19:53512889-53512911 GAAGGCAGTTTTTCCACAGACGG - Intergenic
1168211207 19:54891829-54891851 GAAAACGCTTTTTCCAAACAAGG - Intergenic
1168582673 19:57568675-57568697 GAAGACAATTTTTCTATGGATGG + Intergenic
1202666063 1_KI270708v1_random:120859-120881 GAAGACAATTTTTCCACAGATGG - Intergenic
1202706033 1_KI270713v1_random:24517-24539 GAAGACAATTTTTCCATGGAAGG + Intergenic
925007073 2:451916-451938 GAAGACAGTTTTTCCACGGATGG + Intergenic
925439448 2:3871747-3871769 GAAGAAAATTTTTCCATGGATGG + Intergenic
925538294 2:4939562-4939584 GAAGACAACTTTTCCATGGACGG + Intergenic
926176419 2:10596230-10596252 GAAGACAAGTTTTCCACAGATGG + Intronic
926930708 2:18037793-18037815 GAAGACAATTTTTCCATGGATGG + Intronic
927229784 2:20810956-20810978 GAAGTCAATTTTTCCACAAATGG - Intronic
927259449 2:21072442-21072464 GAAGACAGTTTTTCCACGGATGG + Intergenic
927298556 2:21483823-21483845 GAAACCAATTTTTCCACAGATGG - Intergenic
927505116 2:23607830-23607852 GAAGACAATTTTTCCATGGATGG - Intronic
927924040 2:26997166-26997188 GAAGACAGTTTTTCCATGGATGG + Intronic
928252341 2:29692427-29692449 GAAGACAATTTTTCCACGGATGG + Intronic
928344329 2:30476750-30476772 GAAGACGATTTTTCCATGGATGG - Intronic
928930520 2:36619322-36619344 GAAGACAATTTTTCCGTGGATGG - Intronic
929008305 2:37416533-37416555 GAAGACAATTTTTCCACAAAGGG - Intergenic
929104038 2:38346530-38346552 AAAGACAAGTTTTCCACAGAAGG + Intronic
929184398 2:39078719-39078741 GAAGACAATTTTTCCATGGTGGG - Intronic
929205377 2:39286110-39286132 GAAGACAATTTTTCCACAGATGG + Intronic
929390331 2:41461903-41461925 GAAGACAATTTTTCCACAGATGG + Intergenic
929409751 2:41684636-41684658 GAAGACAGTTTTTCCATGGATGG - Intergenic
929815809 2:45230392-45230414 GAAGACAATTTTTCCACAGAAGG - Intergenic
929895853 2:45960427-45960449 GAAGACAGTTTTTCCACTGATGG + Intronic
930222642 2:48760827-48760849 GAAGACAGTTTTTCCACGGATGG + Intronic
930372150 2:50515423-50515445 GAAGACAATTTTACCACAGACGG - Intronic
930650254 2:53957225-53957247 GAAAACAATTTTTCCACAGATGG + Intronic
930683971 2:54288014-54288036 GAATACCCCTTTTCCACAGAGGG - Intronic
930706687 2:54511468-54511490 GAAGACAGTTTTTCCACTGACGG + Intronic
930842634 2:55864627-55864649 GAAGACAATTTTTCCATGGGTGG + Intergenic
930935921 2:56951407-56951429 GAAGACAATTTTCCCACAGATGG + Intergenic
931139822 2:59445300-59445322 GAAGACAATTTTTCCATGAATGG + Intergenic
931589740 2:63869846-63869868 GAAGGCAATTTTTCCAGTGATGG - Intronic
931851290 2:66253299-66253321 GAATATGAGATTTCCACAGATGG - Intergenic
932054372 2:68429835-68429857 GAAGACAATTTTTCCACAGATGG - Intergenic
932250915 2:70242882-70242904 GAAGACAATTTTTCCATGGGCGG - Intronic
932605177 2:73160557-73160579 GAAGACAATTTTTCCATGGATGG + Intergenic
932959981 2:76402252-76402274 GAAGAAAATTTTTCCACAGGTGG - Intergenic
933056995 2:77683126-77683148 GAAGACAATTTTTCCACAGATGG + Intergenic
933071988 2:77870736-77870758 GAAGACAATTTTTCCACAGATGG + Intergenic
933074699 2:77908125-77908147 GAAGACAGTTTTTCCACAGTTGG - Intergenic
933076167 2:77929867-77929889 GAAGACAATTTTTCCAGACTTGG + Intergenic
933087850 2:78078129-78078151 GAAGATGATATAGCCACAGAGGG - Intergenic
933380642 2:81539420-81539442 GAAGACAATTTTCCCAGGGATGG + Intergenic
933450333 2:82441371-82441393 GAAGACAATTTTTCCATGGATGG - Intergenic
933845547 2:86323638-86323660 GAAGACAGTTTTTCCATGGATGG - Intronic
933927127 2:87104269-87104291 GAAGACAATTTTTCCACAGATGG + Intergenic
934625761 2:95849486-95849508 AAAGATAATTTTTCCACAGATGG + Intronic
934671459 2:96216051-96216073 GGAGACAGTTTTTCCACGGACGG + Intergenic
934807811 2:97251832-97251854 AAAGATAATTTTTCCACAGATGG - Intronic
934829699 2:97505355-97505377 AAAGATAATTTTTCCACAGATGG + Exonic
934876066 2:97922055-97922077 GAAGACAATTTTTCCATGGATGG + Intronic
934885841 2:98023515-98023537 GAAGATAACTTTTCTACAGATGG - Intergenic
934954059 2:98601922-98601944 GAAGACAATCTTTCCACGGACGG - Intronic
935554825 2:104498134-104498156 TAAGATGATTTTGCCACAGGAGG + Intergenic
935611189 2:105027374-105027396 GAAGACAATTTTTCCACCAATGG + Intergenic
936139596 2:109928048-109928070 GAAAGCAATTTTTCCACAGACGG - Intergenic
936205100 2:110443438-110443460 GAAAGCAATTTTTCCACAGACGG + Intronic
936258340 2:110935826-110935848 GAAGACAATTTTTCCATGGATGG + Intronic
936268067 2:111026000-111026022 GAAAACAATTTTTCAACAAATGG - Intronic
936631702 2:114210421-114210443 GAAGACAATTTTTCCACGGACGG + Intergenic
937167197 2:119831035-119831057 GAAGACAATTTTTCCATGGATGG + Intronic
937421531 2:121760318-121760340 GAAGACAATTTTTCCACAGAAGG - Intronic
937434706 2:121870784-121870806 GCTGACTATTTTTCCAGAGAGGG + Intergenic
937455325 2:122036345-122036367 GAAGACAATTTCTCCATGGACGG - Intergenic
937543410 2:122987185-122987207 GAATATGATTTCTACACAGATGG + Intergenic
937996322 2:127697487-127697509 GTAGACGGGGTTTCCACAGATGG - Intergenic
938698670 2:133857395-133857417 GGAGACAATTTTTCCACAGATGG - Intergenic
938876519 2:135536985-135537007 GAAAATAATTTTTCCCCAGATGG - Intronic
940312374 2:152292131-152292153 GAAGACAATTTTTCCATGGATGG - Intergenic
940430139 2:153579893-153579915 GAAGACAATTTTTCCACAGAAGG - Intergenic
940623945 2:156149289-156149311 GAAGACAATTTTTGCATGGATGG - Intergenic
940769563 2:157825692-157825714 GAAGACATTTTTTCTACGGATGG - Intronic
940948462 2:159645374-159645396 GAAGACAATTTTCCCACAGATGG + Intergenic
941115976 2:161472683-161472705 GAAGACAGTTTTCCCATAGATGG + Intronic
941367313 2:164623109-164623131 GAAGAAAATTTTTCCACGGATGG - Intergenic
941936488 2:170985409-170985431 GAAGACAGTTTTTCCTCGGATGG + Intergenic
942104938 2:172624531-172624553 GAAGACAATTTTTCCATGGATGG - Intergenic
942235801 2:173903970-173903992 GAAGACAATTTTTTCATGGATGG + Intergenic
942254740 2:174085503-174085525 GAAGACAATTTTTCCATGGGTGG - Intronic
942345167 2:174995440-174995462 GAAGACAATTTTTCCATGGACGG + Intronic
942479517 2:176368904-176368926 GAAGATAATTTTTCCATAGGGGG - Intergenic
942565072 2:177257901-177257923 GAAGACAGTTTTTCCATAGAAGG - Intronic
942934449 2:181538055-181538077 GAAGACAATTTTTCCGTGGATGG - Intronic
942944768 2:181660066-181660088 GAAGACAGTTTTTCCACGGATGG + Intronic
943086557 2:183318619-183318641 GAAGACAATTTTTCCACAGATGG - Intergenic
943120047 2:183724370-183724392 GAAGACAGTTTTTCCACAGATGG - Intergenic
943156606 2:184187501-184187523 GAAGACAATTTTTCCACATATGG + Intergenic
943244689 2:185431501-185431523 GAAGACAATTTTTCCACAGAAGG - Intergenic
943256736 2:185603003-185603025 GAAGACAATTTTTACACGGATGG - Intergenic
943648842 2:190435075-190435097 GAAGATAATTTTTCCTCAGATGG - Intronic
943745170 2:191454687-191454709 GAAGACAATTTTTTCACAGTTGG + Intergenic
944068758 2:195646894-195646916 GAAGACACTTTTTCCACAGATGG - Intronic
944069468 2:195653027-195653049 GAAGACAATTTTTCCACAGATGG - Intronic
944318663 2:198310848-198310870 GCAGAAAATTTTTCCACAAATGG + Intronic
944399637 2:199310594-199310616 GGAGCTTATTTTTCCACAGATGG - Intronic
944445672 2:199785883-199785905 GAAGACAATTTTTCCATGGATGG + Intronic
945104013 2:206291193-206291215 GAAGACAATTTTTCCACAGATGG + Intronic
945122934 2:206476631-206476653 GAAGATAATTTTTCCACGGATGG - Intronic
945149844 2:206778905-206778927 GAAGACAATTTTTCCAGACTGGG - Intronic
945794302 2:214342698-214342720 GAAGACAATTTTTCCACTGGGGG - Intronic
945933447 2:215879797-215879819 GAAGACTATTTTTCCACAGATGG + Intergenic
945986499 2:216358714-216358736 GAAGGCTTTTTTTCCAGAGATGG - Intronic
946373177 2:219292967-219292989 GAAGACAATTTTTCCACGGCTGG - Intronic
946436895 2:219663072-219663094 GAAGACAATTTTTCCATGGATGG + Intergenic
946502748 2:220267193-220267215 GAAGACAATTTTTCCATGGATGG + Intergenic
946563888 2:220941975-220941997 GAAGACAATTTTTCTACAGATGG + Intergenic
946649476 2:221875257-221875279 GAAGACAATTTTTCCACGGATGG - Intergenic
946739795 2:222790241-222790263 GAAAACAATTTTTCCACAGACGG + Intergenic
946934077 2:224701317-224701339 GAAGACAATTTTTCTATGGATGG - Intergenic
947000880 2:225454783-225454805 GAAGACACTTTTTCCACAGATGG - Intronic
947113476 2:226744731-226744753 GAAGACAATTTTTCCATGGCTGG - Intronic
947541695 2:230984435-230984457 AAAGACGCTTTTTCCAAATAAGG + Intergenic
947658852 2:231851612-231851634 GAAAACAATTTTTCCACAGACGG + Intergenic
947775647 2:232706994-232707016 TAAGCCATTTTTTCCACAGAGGG - Intronic
947829414 2:233128259-233128281 GAAGACAATTATTCCACGGATGG - Intronic
947916377 2:233834443-233834465 GAAGACCACTGTTCCAGAGAAGG - Intronic
948087680 2:235265162-235265184 GAAGACAGTTTTTCCATGGATGG - Intergenic
948118298 2:235510230-235510252 GAAGACAATTTTCCCACTGAAGG - Intronic
948271147 2:236674188-236674210 GAAGACCATTTTTCCACAGAGGG + Intergenic
948539802 2:238682518-238682540 GAAGACAATTTTTCCACAGATGG + Intergenic
948757607 2:240168495-240168517 GAAGACAATTTTTCCACGGATGG + Intergenic
1168747320 20:254679-254701 GAAGACAATTTTTCCATGGTCGG + Intergenic
1168987784 20:2065016-2065038 GAAAACAATTTTTCCACGGATGG - Intergenic
1169254610 20:4087252-4087274 GAAGACAATTTTTCCTCAGACGG + Intergenic
1169322055 20:4640994-4641016 GAAGAAAACTTTTCCACAGATGG - Intergenic
1169527456 20:6445417-6445439 GAAGACAATTTTTTCACAGATGG - Intergenic
1169946713 20:10996738-10996760 GAAGACAATTTTTTCACGGACGG - Intergenic
1170187030 20:13602584-13602606 GAAGACAATTTTTCCATGGATGG + Intronic
1170279770 20:14633303-14633325 TAAGACCCTTTTTCCACAGACGG + Intronic
1170314120 20:15025120-15025142 GAAGACTATTTTTTCACAGTGGG + Intronic
1170417947 20:16164389-16164411 GAAGACAATTATTCCACAGGTGG + Intergenic
1170561173 20:17559830-17559852 GAAGACAATTTTTCCACAGACGG - Intronic
1171050214 20:21851073-21851095 GAAGACAACTTTTCCACAGATGG + Intergenic
1171218630 20:23373219-23373241 GAAGACAATTTTCCCACAGGTGG + Intergenic
1172497877 20:35402094-35402116 CAAAAGGATATTTCCACAGAGGG + Intronic
1172575504 20:36005214-36005236 GAAGACAATTTTTTCACAGATGG + Intronic
1172643209 20:36454310-36454332 CATGACAATTTTTCAACAGATGG - Intronic
1173477153 20:43368223-43368245 GAAGACAATATTTCCACGGATGG - Intergenic
1173926012 20:46781811-46781833 GAACACAGTTTTTCCACAGATGG + Intergenic
1174093338 20:48067402-48067424 GAAGACAATTTTTCAACGCATGG + Intergenic
1174253866 20:49239467-49239489 GAAGACAATGTTTCCACATTTGG + Intronic
1174623407 20:51894611-51894633 TAAGACAATTTTTCCATGGATGG + Intergenic
1174866562 20:54142042-54142064 GAAGACAATTTTTCCACAAATGG + Intergenic
1174906455 20:54557255-54557277 GAAGACAATTTTTCCACAGACGG + Intronic
1175091845 20:56511426-56511448 GAAGACAATCTTTCCATAGATGG - Intronic
1175211720 20:57362112-57362134 GAAGACAATTTTTCCAGACTGGG - Intronic
1175651657 20:60729905-60729927 GGAGACAATTTTTCCATGGACGG - Intergenic
1175964610 20:62654314-62654336 AAAGACGCTTTTTCCAAATAAGG + Intronic
1176973813 21:15295696-15295718 GAAGACAATTTTTCCTCGGACGG + Intergenic
1177061839 21:16385644-16385666 AGAGAAGATTTTCCCACAGACGG + Intergenic
1177417186 21:20808993-20809015 GAAGACAATTTTTCCATGGATGG - Intergenic
1177582511 21:23044300-23044322 GAAGGCATTTTTTCCACAGCCGG - Intergenic
1178105719 21:29317205-29317227 GAAGACAAATTTTCCCCACATGG - Intronic
1178157679 21:29873862-29873884 GAAGACAATTTTTCCACGGATGG + Intronic
1178319781 21:31596590-31596612 GGAGACAATTTTTCCATACATGG - Intergenic
1178415928 21:32405109-32405131 TAAGACAATTTTTCCAAAGATGG + Intergenic
1178475027 21:32930527-32930549 GAAGACAATTTTTCCATGGATGG + Intergenic
1178844843 21:36166124-36166146 GAAGACAATTTCTCCACAGATGG - Intronic
1179186519 21:39089208-39089230 GGAGGCAATTTTTCCACACACGG + Intergenic
1179378266 21:40873091-40873113 GAAGACAATTTTTCCACAGGCGG + Intergenic
1179426985 21:41289403-41289425 GAAGACAGTTTTTCCACGGGTGG + Intergenic
1179898068 21:44374373-44374395 GAAGAGAGTTTTTCCACAGATGG + Intronic
1180938517 22:19641723-19641745 GAAGACAATTTTTCCACCGATGG - Intergenic
1181020109 22:20095646-20095668 GAAGACAATTTTTCCACAGACGG + Intronic
1181460664 22:23084056-23084078 GCAGGCGATCTTTCCCCAGAGGG + Intronic
1181567377 22:23747453-23747475 GAAGACAATTTTTCCATGAATGG - Intronic
1181846834 22:25717017-25717039 GAAGACAATTTTTCCACAGACGG - Intronic
1182220924 22:28758072-28758094 GAAGACTGTTTTTCCATGGATGG - Intergenic
1183027083 22:35073333-35073355 GAAGATGATTTTTCCATGGACGG + Intronic
1183461360 22:37952968-37952990 GAAGACAATTTTTCCACTGACGG - Intronic
1184154759 22:42660098-42660120 GAAGACAACGTTTCCACGGATGG - Intergenic
1184706311 22:46215950-46215972 GAAGACAATTTTTCCACAGATGG - Intronic
1185125464 22:49008306-49008328 GAAGACGATATTTCCACGGACGG + Intergenic
1185189453 22:49425199-49425221 GAAGACAATTTTCCCACGGATGG + Intronic
949333778 3:2951231-2951253 GAAGACAATTTTTCCACAGATGG + Intronic
949353986 3:3158110-3158132 GAAAACAGTTTTTCCAAAGATGG + Intronic
949403864 3:3694214-3694236 GAAGACAATTTTTCCACAGACGG - Intergenic
949434407 3:4013041-4013063 GAAGACAATTTTTCCCCATATGG + Intronic
949919303 3:8988715-8988737 GAAGACAATTTTTCCACAGATGG + Intronic
950001661 3:9661255-9661277 GAAAACAATTTTTCCACGGCAGG + Intronic
950219024 3:11180301-11180323 GAAGACAATTTTTCCACGGACGG + Intronic
950250254 3:11459026-11459048 GAAGACAATTTTTCCATAGATGG - Intronic
950624928 3:14238317-14238339 GAAGACGATTTTTCCACAGATGG + Intergenic
950688912 3:14640159-14640181 GATGACGATTTTTCTTCAGGTGG - Intergenic
950826673 3:15830589-15830611 GAAGACAATTTTTCCGTGGATGG - Intronic
950969208 3:17169826-17169848 GAAGACAATTTTTCCACAAACGG + Intronic
951011856 3:17690792-17690814 GAAGACAGTTTTTCCATGGATGG - Intronic
951050671 3:18089653-18089675 GAAGACAATTTTTCCACGAATGG - Intronic
951301558 3:21004426-21004448 AAAGACAATTTTTCCATGGATGG + Intergenic
951480652 3:23159083-23159105 GAAGACAATTTTTCCATGGATGG + Intergenic
951509935 3:23489145-23489167 GAAGACAGTTTTTCAACAGACGG + Intronic
951551432 3:23878916-23878938 GAAGACAATTTTTCCACAGATGG - Intronic
951553623 3:23899031-23899053 GATGACAATTTTTCCACAGATGG - Intronic
951944218 3:28115700-28115722 GAAGACAATTTTTCCACAGACGG - Intergenic
952248708 3:31627389-31627411 GAAGACAATTTTTCCACGGATGG - Intronic
952271271 3:31834316-31834338 GACTCCGAATTTTCCACAGATGG - Intronic
952336519 3:32407957-32407979 GAAGACGGTTTTTCCAAGTAAGG - Intronic
952459001 3:33504649-33504671 GAAGGCAATTTTTCCACGGATGG + Intronic
952474212 3:33689435-33689457 GAAGAAAATTTTTTCACAGGTGG - Intronic
952600235 3:35071113-35071135 GAAGATATTTTTTCCACAGAAGG - Intergenic
952756988 3:36878311-36878333 CAAGACGATTTTTCCACAGATGG - Intronic
953227418 3:41033436-41033458 GAAGACAATTTTTCCACGGATGG + Intergenic
953531795 3:43746145-43746167 GAAGACAATTTTTCCATGGATGG + Intergenic
953707019 3:45238889-45238911 GAAGACAATTTTTCCACACATGG - Intergenic
953748393 3:45592405-45592427 GAAGCCAATTTTTTCACAGACGG + Intronic
954058184 3:48045565-48045587 GAAGACAGTTTTTCCATGGAAGG - Intronic
954592199 3:51792490-51792512 GAAGACAATTTTTCCATGGACGG + Intergenic
954820914 3:53326870-53326892 GAAGACCATTTTTCAATGGACGG - Intronic
955022281 3:55132870-55132892 GAAGGCAATTTTTCCAGGGATGG - Intergenic
955572775 3:60326116-60326138 GAAGACAATTTTTCCACAGATGG + Intronic
955617625 3:60825748-60825770 GAAGATAATTTTTCCATGGATGG - Intronic
955623930 3:60896181-60896203 GAAGACAATTTTTCCATCGGTGG - Intronic
955728578 3:61959374-61959396 GAAGACAATTTTTCCATGGGGGG + Intronic
955859414 3:63311596-63311618 GAAGACGATTTTTCCATGGACGG - Intronic
955904164 3:63789293-63789315 GAAGACAATTTTTCCATGAATGG - Intergenic
956248018 3:67205492-67205514 GAAGAAAATTTTTCCATGGATGG - Intergenic
956298240 3:67738220-67738242 GAAAGCACTTTTTCCACAGATGG + Intergenic
956315682 3:67933951-67933973 GTAGACAATTTTTCCACAGATGG + Intergenic
956335815 3:68162263-68162285 GAAGAAAATTTTTCCACAGATGG + Intronic
956987898 3:74724442-74724464 GAAGACAATTTTTCCATGAATGG - Intergenic
957089834 3:75718603-75718625 GAAGACAATTTTTCCACAGATGG + Intronic
957150902 3:76485058-76485080 GAAGGCAATTTTTCCTCAAACGG + Intronic
957163066 3:76635039-76635061 GAAGACAGTTTTTCCACAGTGGG - Intronic
957212774 3:77281719-77281741 GAAGATGATATTTCCATGGATGG + Intronic
957340677 3:78892309-78892331 AAAGACAACTTTTCCACAGATGG - Intronic
957553231 3:81733455-81733477 GAAGACAATTTTTCCATGAATGG - Intronic
957724206 3:84044028-84044050 GAAGACAATTTATCCATAGATGG + Intergenic
957783097 3:84845056-84845078 GAAAACAATTTTTCCATGGATGG - Intergenic
957801588 3:85090892-85090914 GAAGATAATTTTTCCACAGATGG - Intronic
957856169 3:85881788-85881810 GAAGACAATTTTTCCATGGATGG + Intronic
958133339 3:89457556-89457578 GAAGACAATTTTTCCACGAATGG - Intronic
958897368 3:99843999-99844021 GAAGACAATTTTTCCATGGGCGG - Intronic
958920255 3:100097249-100097271 GAAGACAATTTTTCCACGGATGG - Intronic
958946812 3:100371728-100371750 GAAGACAATTTTTGCATGGATGG + Intronic
959040883 3:101422265-101422287 GAAGCCAATTTTTCCACGGATGG - Intronic
959087827 3:101869828-101869850 GAAGACAGTTTTTCCATGGATGG + Intergenic
959106526 3:102071153-102071175 GAAGACAATTTTTCCATGGATGG + Intergenic
959181496 3:102986154-102986176 GAAGACAATTTTTCCATGGTTGG + Intergenic
959294272 3:104515176-104515198 GAAGACAATTTTTCCATAGATGG - Intergenic
959386432 3:105714262-105714284 GAAGACATTTTTTCCACGAACGG + Intronic
959550502 3:107650404-107650426 GAAGACAATTTTTCCACGAATGG - Intronic
959638622 3:108605487-108605509 GAAAACAATTTTTCCACGGATGG + Intronic
960086144 3:113593469-113593491 AAAGACAATTTTTCCACAGACGG - Intronic
960443179 3:117714567-117714589 GAAGACAATTTTTCCATGGATGG - Intergenic
960604396 3:119489962-119489984 GGAGACAATTTTTCCATGGATGG - Intronic
960614338 3:119582991-119583013 GAAGATAATTTTTCCATGGACGG - Intronic
960879673 3:122331871-122331893 GAAGGCAATTTTTCCACAGATGG + Intronic
960960194 3:123065349-123065371 GAAGACAAGTTTTCCACAGATGG + Intergenic
960976972 3:123185016-123185038 GAACACAATTTTTCCATGGATGG + Intronic
961230564 3:125303795-125303817 GAAGACAGTTTTTCCACGAATGG - Intronic
961727259 3:128939711-128939733 GAAGACAATTTTTCCACGGACGG + Intronic
961842048 3:129722415-129722437 GAAGACAATTTTTCCACAGATGG - Intronic
962154866 3:132935349-132935371 GAAGACAGTTTTTCCAAGGATGG - Intergenic
962244947 3:133784718-133784740 GAAGGCAATTTTTCCATGGAAGG - Intronic
962290155 3:134129001-134129023 GAAGTCAGTTTTTCCACAGATGG + Intronic
962505171 3:136039450-136039472 GAAGACAGTTTTTCCATGGATGG + Intronic
962574623 3:136745432-136745454 GAAAAAAATTTTTCCACGGATGG + Intronic
962585034 3:136833498-136833520 GAAGACAGTTTTTCCATGGAAGG + Intronic
962856353 3:139349271-139349293 TAATACAATTTTTCCTCAGAAGG - Intronic
962857659 3:139363472-139363494 ATAGACAATTTTTCCACAGATGG - Intronic
962950740 3:140216222-140216244 GAAGATAATTTTTCCATGGATGG - Intronic
963118355 3:141753406-141753428 GAAGACAATTTTTCCACAGTGGG + Intergenic
963155491 3:142091683-142091705 GAAGACAATTTTTCCATGGATGG + Intronic
963820958 3:149892765-149892787 GAAGACAACTTTTCCACCGGGGG - Intronic
963890573 3:150631830-150631852 GAAGACAAATTTTCCATAAACGG - Intergenic
964209619 3:154212572-154212594 GAAGACGATTTTTCCACAGACGG + Intronic
964264037 3:154873932-154873954 GAAGACAATTTTTCCACAGATGG - Intergenic
964583119 3:158262002-158262024 AAAGACGATTTTTCCATGGATGG - Intronic
965946075 3:174242809-174242831 GAAGCCAATTTTTCCATGGATGG - Intronic
966090090 3:176123202-176123224 GAAGAAAATTTTTCCATGGATGG - Intergenic
966148788 3:176843061-176843083 GAATAGCATTTTTCCACAGATGG + Intergenic
966217895 3:177521239-177521261 GGAGACAATTTTTCCATGGACGG + Intergenic
966510860 3:180761506-180761528 GAAGACAATTTTTCCACACAAGG - Intronic
966563711 3:181352219-181352241 GAAGACAGTTTTTCCACAGATGG + Intergenic
967483183 3:189998802-189998824 GAAGACAATTTTTCCATGGATGG + Intronic
968812944 4:2808391-2808413 GAAGACCCTTTTTCCAAATAAGG + Intronic
969592740 4:8131142-8131164 AAAGACCCTTTTTCCACATAAGG + Intronic
969699214 4:8757196-8757218 GAAGACCATTTTTCCAGGGTAGG - Intergenic
969927898 4:10602344-10602366 AAAGACGCTTTTTCCAAATAAGG - Intronic
970181032 4:13394250-13394272 GAAGACAATTTTTCCACAGATGG + Intronic
970336458 4:15050340-15050362 GACAACAATTTTTCCACAGCAGG - Intronic
970620800 4:17816129-17816151 GAAGACAGTTTTTCCACAGAGGG + Intronic
970869047 4:20793596-20793618 GAAGACACTTTTTCCACGGATGG + Intronic
971015759 4:22487299-22487321 GAAGACAATTTTTCCATGGATGG + Intronic
971118914 4:23681791-23681813 GAAGACAATTTTTCCAAGGTGGG + Intergenic
971863611 4:32140597-32140619 GAAGACAATTTTTCCATGGATGG - Intergenic
972078343 4:35115834-35115856 GAAGAACATTTTTCCATGGATGG + Intergenic
972670440 4:41209930-41209952 GAAGACAATTTTTCCACGGATGG + Intronic
972744839 4:41922768-41922790 GAAGACAATTTTTCCACAGACGG - Intergenic
973117471 4:46478885-46478907 GGAGATAATTTTTCCACGGACGG - Intergenic
974126288 4:57700283-57700305 CAAAATGATTTTTCCATAGAAGG + Intergenic
974435243 4:61848551-61848573 GAAGACCATATTTCCAAATAAGG + Intronic
974811162 4:66947808-66947830 GAAGACAGTTTTTCCACGGATGG - Intergenic
975399476 4:73917846-73917868 GAAGACAATTTTTCCAAGGATGG - Intergenic
975624133 4:76325988-76326010 GAAGCTGAGTTTTTCACAGATGG + Exonic
975646955 4:76555183-76555205 GAAGACAATTTTTCCACGGATGG - Intronic
975798751 4:78036433-78036455 GAAGACAATTTTTCCATGGATGG + Intergenic
976214081 4:82699150-82699172 GAAGGCAATTTTTCCATAGATGG - Intronic
976417900 4:84800676-84800698 GAAGACAATTTTTTCACAGATGG + Intronic
976512010 4:85921924-85921946 GAAGACATTGTTTCCACAAATGG - Intronic
976576028 4:86672915-86672937 GAAGACAGTTTTTCCAAGGATGG + Intronic
976674599 4:87690569-87690591 AAAGACAATTTTTCCATGGATGG - Intergenic
976676196 4:87706089-87706111 AAAGACCCTTTTTCCAAAGAAGG + Intergenic
976822293 4:89220058-89220080 GAAGACAATTTTTCCATGGATGG - Intergenic
976989002 4:91340394-91340416 GAAGAATTTTTTTCCCCAGAGGG + Intronic
977048744 4:92099919-92099941 GAAGACAGATTTTCCTCAGAGGG + Intergenic
977092038 4:92689673-92689695 GAAGACAATGTTTCTAAAGATGG - Intronic
977235184 4:94499955-94499977 GAAGACAATTTTTCCACAGGTGG - Intronic
977429754 4:96916580-96916602 GAAGACAATATTTTCACAGACGG + Intergenic
977810525 4:101350197-101350219 GAAGACAATTTTCCCATGGATGG + Intergenic
977957942 4:103052134-103052156 GAAGACGATTTTTCCACTGATGG + Intronic
978291938 4:107152181-107152203 GAAGACAATTTTTCCACTGAGGG + Intronic
978479704 4:109175081-109175103 GAAGACAACTTTTACACAGATGG - Intronic
978637248 4:110824205-110824227 GAAGACAGTTTTTCCACCAATGG + Intergenic
978704727 4:111692860-111692882 GAAGACAGTTTTTCAACAGACGG - Intergenic
979201575 4:117985398-117985420 GAAGACAATTTTTCCATGAACGG - Intergenic
979402511 4:120265901-120265923 GAAGACTATTTTTCCAAGGATGG - Intergenic
979423811 4:120539369-120539391 GAAGACAGTTTTTCCATGGATGG - Intergenic
979539425 4:121864158-121864180 GAAGACAGTTTTTCCACCAATGG - Intronic
979542283 4:121898529-121898551 GAAGACAATTTTTTCACAGATGG - Intronic
979661524 4:123261095-123261117 GAAGACAATTTTTCCACAAATGG - Intronic
980193138 4:129551313-129551335 AAAGACAATTTTTCCGCGGATGG - Intergenic
980501112 4:133655622-133655644 GGAGACAGTTTTTCTACAGATGG + Intergenic
980508304 4:133752572-133752594 GAAGACAATTTTTCCACAGACGG - Intergenic
980579364 4:134729830-134729852 GAAGACAATTTTTCCACCAGTGG - Intergenic
980627292 4:135390249-135390271 GAAGACAGTTTTTCCATGGATGG + Intergenic
980822837 4:138038987-138039009 GAAAACAATTTTGCCACTGATGG - Intergenic
980910865 4:138993115-138993137 GAAGACAATTTTTCCACGGACGG - Intergenic
981269072 4:142822629-142822651 GAAGACAGTTTTTACACGGATGG - Intronic
982164668 4:152603900-152603922 AAAGACCATTTTTCCAAATAAGG - Intergenic
982484562 4:155951912-155951934 GAAGACATTTTTTCCATGGACGG - Intronic
982896915 4:160941998-160942020 GAAGACAAGTTTTCCACAGATGG + Intergenic
983040864 4:162924050-162924072 GTAGACAATGTTTCCATAGATGG - Intergenic
983251813 4:165354234-165354256 GCAGACAATTTTTTCACAGACGG + Intergenic
983354100 4:166633081-166633103 GAAAACAATTTTTCCACAAATGG + Intergenic
983637653 4:169914544-169914566 GAAGACAATTTTTCCATGGATGG + Intergenic
983700092 4:170581390-170581412 GAAGACAATTTTTCCACAGAAGG + Intergenic
983849604 4:172563811-172563833 GAAGACCATTTCTCCAAATATGG + Intronic
983888126 4:173003620-173003642 GAAGACGATCATGCCTCAGAGGG - Intronic
984079836 4:175233517-175233539 GAAGACAATTTTCCCACGAATGG - Intergenic
984080221 4:175238522-175238544 AAAGACAATTTTTCCACGAATGG - Intergenic
984081032 4:175250299-175250321 GAATACAATTTTTCCATGGATGG + Intergenic
984364924 4:178786266-178786288 GAAGATAATTTTTCCATGGATGG + Intergenic
984385266 4:179047838-179047860 GAAGACAATTTTTCCAGGGATGG + Intergenic
984461372 4:180041165-180041187 GAAGACAATTTTTCCATGGAAGG + Intergenic
984466751 4:180109461-180109483 GAAAACAATTTTTCCACAGATGG - Intergenic
984630957 4:182060313-182060335 GAAGACCATTTCTCCATGGATGG + Intergenic
984642650 4:182185743-182185765 GAAGCAGAAATTTCCACAGAGGG - Intronic
984770411 4:183432374-183432396 GAAGACACTTTTTCCATGGAAGG + Intergenic
984772861 4:183453386-183453408 GAAGACCATTTTTCCACGGATGG + Intergenic
984900939 4:184585852-184585874 AAAGACAAGTTTTCCACAGGGGG - Intergenic
984971033 4:185190793-185190815 GAAGATGATTACTACACAGATGG - Exonic
985124864 4:186683116-186683138 GAAGACAATTTTTAATCAGAGGG - Intronic
985160979 4:187044285-187044307 GAAGACAATGTTTCCATGGACGG - Intergenic
985636903 5:1040230-1040252 GAAGACAAGTTTTCCACGGACGG - Intergenic
985887318 5:2689641-2689663 GAAGACAATTTTTCCATAGATGG - Intergenic
986112303 5:4731319-4731341 GAAGACAATGTTTCCATGGACGG - Intergenic
986373427 5:7105204-7105226 GAAGACAATTTTTCCATGGACGG + Intergenic
986567765 5:9132179-9132201 GAAGACTTATTTTCTACAGAGGG - Intronic
986837969 5:11662826-11662848 GAAGACAGTTTTTCCATGGACGG - Intronic
987012865 5:13784959-13784981 GAAGACAATTTTTCCACGGATGG + Intronic
987035246 5:14012800-14012822 AAAGACAGTTTTTCCACAGGTGG + Intergenic
987091674 5:14513265-14513287 GAAGACAGTTTTTCCATGGATGG + Intronic
987134979 5:14892009-14892031 GAAGACAATTTTTCCGCAGATGG - Intergenic
987439784 5:17941844-17941866 GAAGACAATTTTTCCATGGCTGG + Intergenic
987443521 5:17986887-17986909 GAAGACATTTTTTCCATGGATGG + Intergenic
987742592 5:21929183-21929205 GAAGACAATTCTTCCATGGATGG + Intronic
988013041 5:25515454-25515476 AAAGAAAATTTTTCCACAGAAGG + Intergenic
988062475 5:26190373-26190395 GAAGACAATCTATCCATAGATGG + Intergenic
988095647 5:26605866-26605888 GAAGACAATTTTTCCATGGATGG - Intergenic
988112102 5:26835030-26835052 GAAGACAATTTTTCCAGGGATGG - Intergenic
988390052 5:30616179-30616201 GAAGACAATTTTTCCACGGATGG - Intergenic
988392909 5:30658865-30658887 GAAGACAATTTTTCCATGGATGG + Intergenic
988527702 5:32001119-32001141 GAAGACAATTTTTCCAAGGATGG - Intronic
988596325 5:32594822-32594844 GAAGACAATTTTTCCACAGCAGG - Intronic
988626147 5:32876767-32876789 GAAGACAATTTTTCCGCGGATGG - Intergenic
988641737 5:33048317-33048339 GAAGAAAATTTTTCCATGGATGG + Intergenic
988813594 5:34808785-34808807 GAAGATAATTTTTCCATGGATGG + Intronic
988818430 5:34856940-34856962 GAAGATGATTTTACAAGAGAAGG + Intronic
988842730 5:35098538-35098560 CAAGATTATTTTTTCACAGATGG + Intronic
988953270 5:36287021-36287043 GAAGACAATTTTTCCACAGATGG + Intronic
989016072 5:36935997-36936019 AAAGACGCTTTTTCCAAATAAGG + Intronic
989472483 5:41836551-41836573 GAAGACACTTTTTCCACAGATGG + Intronic
989565602 5:42898302-42898324 GAAGGCAATTTTTCCATGGATGG - Intergenic
989566749 5:42908887-42908909 GAATACAATTTTTCTACGGATGG + Intergenic
989567610 5:42916582-42916604 GAAGACAATTTTTCCATGGATGG + Intergenic
989627461 5:43444034-43444056 GAAGACAATTTTTCCACAGATGG - Intergenic
989747475 5:44847230-44847252 GAAGACAGTTTTTCCACGGACGG + Intergenic
990468856 5:56094864-56094886 GAAGACAGTTTTTCCACGGACGG + Intergenic
990650834 5:57897860-57897882 GAAGACAATTTTTCCACGGATGG + Intergenic
990762644 5:59147127-59147149 GAAGACAATTTTTCCATGGATGG - Intronic
990937330 5:61164280-61164302 GAAAACAATTTTTCCATGGACGG - Intergenic
990972142 5:61519797-61519819 GAAGACAGTTTTTCCACGGATGG + Intronic
991036811 5:62135689-62135711 GAAGACAACTTTTCCATAGACGG + Intergenic
991066239 5:62427766-62427788 GAAGACAATTTTTCCACAGATGG - Intronic
991172660 5:63646592-63646614 GAAGACAATTTTTCCACAGATGG + Intergenic
991187302 5:63825146-63825168 GGAGACAATTTTTCCACAGATGG + Intergenic
991192361 5:63889263-63889285 AAAGACAATTTTGCCACAGATGG - Intergenic
991625247 5:68594306-68594328 GAAGATAATTTTTCCACAGATGG - Intergenic
991625499 5:68596689-68596711 GAAGACAGTTTTTCCACAGATGG + Intergenic
991638103 5:68726309-68726331 GAATACGTTGCTTCCACAGATGG - Intergenic
991665601 5:68996661-68996683 GAAGACAATTTTTCTATGGAAGG - Intergenic
991670070 5:69038389-69038411 GAAGACAATTTTTCCACAGATGG + Intergenic
991985957 5:72287217-72287239 GAAGACAGTTTTTCCACAGCTGG - Intronic
992022552 5:72638780-72638802 GAAGACAATTTTTCCACGGATGG + Intergenic
992033625 5:72749289-72749311 GAAGACAATTTTTCCACGGACGG + Intergenic
992109371 5:73478359-73478381 GAAGACAATTTTTCCACGGACGG + Intergenic
992211505 5:74484201-74484223 GAAGACAATTTTTCCATGGACGG - Intergenic
992299593 5:75364581-75364603 GAAGACAATTTTTCTACAGATGG + Intergenic
992566313 5:77998560-77998582 AAAGACAATTTTTCCATGGATGG + Intergenic
992589512 5:78278944-78278966 GAAGACAGTTTTTCCATGGAAGG - Intronic
992605006 5:78447164-78447186 GAAGACAATTTTTCTACGTATGG - Intronic
992816710 5:80448134-80448156 ATAGACAATTTTTCCACTGATGG - Exonic
993157574 5:84244965-84244987 AAAGACAATTTTGCCACAGAAGG - Intronic
993211683 5:84960940-84960962 GAAGACAATTTTTCCACAGATGG + Intergenic
993276845 5:85870945-85870967 AAAGATGATTCCTCCACAGAAGG - Intergenic
993847716 5:92966369-92966391 GAAGACAATTTTTCCACGTATGG - Intergenic
993855265 5:93066386-93066408 GAAGACAATTTTTCCACAGATGG - Intergenic
993860013 5:93124628-93124650 TAAGACAATTTTTCCACAGATGG - Intergenic
993913112 5:93708437-93708459 GAAGACAATTTTTCCACACATGG + Intronic
993954804 5:94219064-94219086 GAAGACAATTTTTCCACAGATGG + Intronic
994112346 5:96020846-96020868 GAAGAAAATTTTTCCACAGATGG - Intergenic
994117133 5:96073544-96073566 GAAGACAATTTTTCCACGGATGG + Intergenic
994151194 5:96449473-96449495 GAAGACAATTTTTCCATGGATGG - Intergenic
994237980 5:97387921-97387943 GAAGGGGATTTTACCACAGGAGG - Intergenic
994297683 5:98110841-98110863 GAAGACAATTTTTCCATGGATGG + Intergenic
994938212 5:106284371-106284393 GACAACAATTTTTCCACGGATGG + Intergenic
994985202 5:106924229-106924251 GAAGACAATTTTTCCATGGACGG - Intergenic
995311399 5:110716264-110716286 GAAGAAAATTTTTCCACAGATGG + Intronic
995403240 5:111765097-111765119 GAAGACAATTTTTCCATGGAAGG + Intronic
995962014 5:117853279-117853301 CAAGACAATTTTTCTACAGATGG + Intergenic
996045019 5:118862229-118862251 GAAGACAGTTTTTCCACGAATGG - Intronic
996331174 5:122330727-122330749 GAAGACAATTTTTCCATAGTTGG + Intronic
996529104 5:124508897-124508919 GAAGACAATTTTCCCACAGATGG - Intergenic
996557717 5:124796319-124796341 AAAGACAATTTTTCCACGGATGG - Intergenic
996614377 5:125422748-125422770 GAAGACGTTTTTTCCATGGAAGG - Intergenic
996626905 5:125580873-125580895 GAAGTCAATATTTCCACGGATGG - Intergenic
996808691 5:127488858-127488880 GAAGATGATTTTTCCATGGATGG + Intergenic
997053572 5:130412895-130412917 GAAGACCATTTTCCCAGAGTGGG + Intergenic
997169461 5:131701233-131701255 GAAGATAATTTTTTCACGGATGG - Intronic
997221972 5:132176775-132176797 GAAGACAATTTTTCCATGGACGG - Intergenic
997281120 5:132646576-132646598 GAAGACAATTTTTCCATGGACGG + Intergenic
997317993 5:132954159-132954181 GACGACAATTTTTCCATGGATGG + Intronic
997715621 5:136040557-136040579 GTAGACAATATTTCCCCAGATGG - Intronic
997924350 5:138014522-138014544 GAAGACAGTTTTTCCACTGATGG - Intronic
998008061 5:138670678-138670700 GAAGACAATTTTTCCACAGACGG + Intronic
998109038 5:139487063-139487085 CAAGACGATTTTTCCATGGATGG + Intergenic
998240782 5:140442398-140442420 GAAGACAATTTTTCCACACGTGG + Intronic
998689966 5:144576859-144576881 GAAGACAATTTTTCCACAGATGG + Intergenic
998840262 5:146245863-146245885 GAATACAATTTTTCCACAAATGG - Intronic
999091546 5:148940714-148940736 AAAGACCATTTTTCCAGATAAGG + Intronic
999193730 5:149767804-149767826 GAAGACAGTTTTTCCACAGATGG + Intronic
999512636 5:152268701-152268723 GAAGACGATTTTTCCACAGATGG + Intergenic
999702363 5:154239576-154239598 GAAGACAATTTTTCCACGGATGG - Intronic
999725716 5:154435658-154435680 GAAGACAATTTTTCCACGGTTGG - Intergenic
999761818 5:154707612-154707634 GAAGACAATTTTTCCACAGCTGG + Intergenic
999941220 5:156545447-156545469 GAAGACAATTTTTTCATGGACGG + Intronic
1000656367 5:163884130-163884152 GAAGACAATTTTTCCATGGATGG + Intergenic
1000896932 5:166866824-166866846 GAAGGCCATTTTTCCAGAGGAGG + Intergenic
1001350229 5:170955129-170955151 GAAGACAATGTTTCCATGGATGG - Intronic
1001807773 5:174602871-174602893 AAAGACGACTTTTCAACAAATGG - Intergenic
1002899848 6:1401388-1401410 AAAGATAATTTTTCCACAGACGG + Intergenic
1002911433 6:1494087-1494109 GAAGATGATTTTTCCACAGATGG + Intergenic
1003143470 6:3490764-3490786 GAAGACATTTTTTCCATGGATGG - Intergenic
1003231970 6:4262404-4262426 GAAGACAATTTTTCCACAGGGGG - Intergenic
1003390065 6:5706037-5706059 GAAGACCATTTTTCCATGGATGG + Intronic
1003747098 6:9014752-9014774 AAAGACCATTTTTCCACAAAAGG - Intergenic
1003779755 6:9411423-9411445 GAAGACAATTTTTCCACAGATGG + Intergenic
1003850738 6:10220013-10220035 GAAGACAATTTTTCCACAAATGG + Intergenic
1003948454 6:11096171-11096193 GAGAACAATTTTTCCACAGACGG + Intronic
1004165028 6:13249374-13249396 GAAGACAATTTTTCTATGGATGG - Intronic
1004373753 6:15074592-15074614 GGAGATAATTTTTCCACAGATGG + Intergenic
1004476650 6:15979516-15979538 GAAGACAATTTTTCCATATGGGG - Intergenic
1004875181 6:19944278-19944300 GAAGACAATTTTTCCACAGATGG + Intergenic
1004911778 6:20292737-20292759 GAAGACAATTTTTCCCCAGATGG + Intergenic
1005086822 6:22015404-22015426 AAAGACAATTTTTCCACGGATGG - Intergenic
1005260178 6:24050529-24050551 GAAGACAGTTTTTCCATGGAAGG - Intergenic
1005283285 6:24298046-24298068 GAAGATAATTTCTCCACAGACGG + Intronic
1005527501 6:26665328-26665350 GAAGACAAATTTTCCACAGATGG - Intergenic
1005588783 6:27303220-27303242 GAAGACAATTTTTCCACGGACGG + Intronic
1006278852 6:33029935-33029957 GAAGAAGAGTATTCAACAGAGGG - Intergenic
1006512819 6:34530776-34530798 GAAGACAATTTTTCCACGGATGG + Intronic
1006703601 6:35997394-35997416 GAAGACAATTTTTCCACAAATGG - Intronic
1006720137 6:36144836-36144858 GAAGACAACTTTTCCATGGATGG + Intergenic
1007051800 6:38838716-38838738 GAAGAGCATTTTACCACAAATGG - Intronic
1007053324 6:38855971-38855993 GAAGACAATTTTTCCATGGACGG - Intronic
1007420948 6:41719383-41719405 GAAGACAGTTTTTCCATGGATGG - Intronic
1007819144 6:44547706-44547728 GAAGACAATTTTTCCACTGCTGG - Intergenic
1007853195 6:44825091-44825113 GAAGACCAGATTTCCCCAGAAGG - Intronic
1008001518 6:46365170-46365192 GAAGACAATTTTTCTACAGATGG - Intronic
1008192886 6:48481846-48481868 GAAGACAATTTTTCCACGGATGG + Intergenic
1008518657 6:52342471-52342493 GGAGACAATTTTTCCATAGATGG - Intergenic
1008523906 6:52388450-52388472 GAAGACAATTTTTCCACGTATGG - Intronic
1008694136 6:54014407-54014429 GAAGACAATTTTTCCACAGATGG + Intronic
1008813294 6:55532027-55532049 GAAGACAATTTTTCCACAAACGG - Intronic
1009289986 6:61869497-61869519 GAAGAAAATTTATCCAAAGAAGG + Intronic
1009303119 6:62052581-62052603 GAAGACAATTTTTCCACTGGTGG + Intronic
1009443084 6:63705598-63705620 GAAGACAATTTTCCCATGGACGG - Intronic
1009517811 6:64641932-64641954 GAAGAAAATTTTTTCACATATGG - Intronic
1009600743 6:65794640-65794662 GAAGACAGTTTTTCCACGAATGG + Intergenic
1010601210 6:77828509-77828531 GAAGACAATTTTTCCATGGAAGG - Intronic
1010680714 6:78795565-78795587 GGAGACAATTTTTCCACAGATGG - Intergenic
1010877153 6:81120770-81120792 GAAGACCACTTTTCCACAGATGG - Intergenic
1011216295 6:85009474-85009496 GAAGACAATTTTTCCATGGAAGG + Intergenic
1011752626 6:90468567-90468589 GAAGATGATTTTTCCACATATGG - Intergenic
1011833193 6:91398656-91398678 GAAGAAAATTTTTCCATGGATGG - Intergenic
1011981271 6:93382202-93382224 GAAGACAATTTTTCCATAAATGG + Intronic
1012425361 6:99108333-99108355 GAAGATGATTCTTCCACAGATGG + Intergenic
1012753234 6:103190079-103190101 GAAGACAATTTTGTCACAGGGGG - Intergenic
1013337715 6:109181684-109181706 GAAGACAATTTTTCCATGGATGG - Intergenic
1013697295 6:112718771-112718793 GAAGACAATTTTTCCTTGGATGG + Intergenic
1014102789 6:117530278-117530300 AAAGACAGTTTTTCCACAGACGG + Intronic
1014147122 6:118011105-118011127 GTAGACAGTTTTTCCACGGATGG + Intronic
1014460415 6:121688075-121688097 GAAGATAATTTTTCCATGGATGG + Intergenic
1014527593 6:122519463-122519485 GAAGAAAATTTTTCCACAGACGG - Intronic
1014703826 6:124722424-124722446 GAAGACAATTTTTCAACAGATGG + Intronic
1014895875 6:126898418-126898440 GAAGACAATTTTTCCATGGATGG + Intergenic
1015465589 6:133544786-133544808 GAAGACAATTTTTCCACAGATGG - Intergenic
1015508504 6:134014109-134014131 GAAGACAATTTTTCCACAGACGG + Intronic
1015553888 6:134440926-134440948 GAAGGCAATTTTTCCACAGATGG - Intergenic
1015672706 6:135708502-135708524 GAAGGCAATTTTTCCACAATGGG + Intergenic
1016007666 6:139105897-139105919 GGAGCCGATTTTCCCTCAGAAGG + Intergenic
1016214942 6:141588198-141588220 GAAGACAATTTTTCCAGGAATGG + Intergenic
1016663010 6:146602891-146602913 GAAGACAATTTTTCCATGGATGG - Intronic
1017055823 6:150434740-150434762 GAAGACAATATTTCCATGGATGG - Intergenic
1017097297 6:150815922-150815944 GAAGATAATTTTTCCACGGATGG + Intronic
1017207548 6:151819779-151819801 GAAGACAATTTTTCCACAGATGG - Intronic
1017230618 6:152069554-152069576 AAAGAAAATTTTTCCACAGATGG + Intronic
1017260101 6:152376014-152376036 GAAGACAATTTTTCCACAGATGG + Intronic
1017318226 6:153057576-153057598 GAAGACAATTTTTCCACGGATGG + Intronic
1017324048 6:153126989-153127011 GAAGACAATTTTTCCACGGATGG + Intronic
1018045863 6:159965777-159965799 GAAGACAATTTTTCCATGGATGG - Intergenic
1018096987 6:160397113-160397135 GAAGACAATTATTCCATGGATGG + Intronic
1018250217 6:161862155-161862177 AAAGACGCTTTTTCCACATATGG + Intronic
1018335605 6:162785543-162785565 GAAGACAGTTTTTGCACAGACGG + Intronic
1019385060 7:750442-750464 GAAGACAATTTTTCCATGGGTGG + Intronic
1020663376 7:11008602-11008624 GAAAACAATTTTTCCATGGATGG - Intronic
1021000503 7:15324645-15324667 GAAGGCAATTTTCCCACAGATGG + Intronic
1021040131 7:15851449-15851471 GAAGACATTTTGTTCACAGATGG - Intergenic
1021090141 7:16473488-16473510 GAAGATGATTTTTCCATGGATGG - Intronic
1021205027 7:17769663-17769685 GAAGACAACTTTTCCACAAATGG - Intergenic
1021217164 7:17930977-17930999 GAAGACAGTTTTTCCACGGACGG - Intronic
1021397593 7:20169364-20169386 GAACACGTTTTTTGCACTGAAGG - Intronic
1021478199 7:21086449-21086471 GAAGACAATTTTTCCATGGATGG - Intergenic
1021560280 7:21962515-21962537 GAAGACAATTTTTCCACGGATGG + Intergenic
1021615311 7:22497920-22497942 GAAGACAATTTTTCCAAGTAGGG + Intronic
1022620973 7:31984372-31984394 GAAGACAATTTTGCCACGGATGG - Intronic
1023041239 7:36174972-36174994 GAAGACGATTTATGGACAGAAGG + Intronic
1023480164 7:40625525-40625547 GAAGACGAATTTTGAACTGATGG - Intronic
1023491040 7:40742382-40742404 GAAGACAGTTTTTCCATGGACGG + Intronic
1023762430 7:43479045-43479067 GAAGGCAATTTTTCCACGGATGG + Intronic
1023915763 7:44587721-44587743 AAAGACTCTTTTTCCACATAAGG - Intergenic
1024997877 7:55287921-55287943 GAAGACTAGTTTCCAACAGAAGG + Intergenic
1025104911 7:56162815-56162837 GAAGGCAATTTTTCCACGGATGG - Intergenic
1026053458 7:66965781-66965803 GAAGACAGTTTTTCCATGGATGG + Intergenic
1026149559 7:67776409-67776431 GAAGACAATTTTTCCAAGGATGG + Intergenic
1026182341 7:68052957-68052979 AAAGACAATTTTTCCATTGATGG + Intergenic
1026300513 7:69093823-69093845 GAAGACAATTTTTCCACAAGAGG + Intergenic
1027589496 7:80099948-80099970 CAAAACTAGTTTTCCACAGAGGG - Intergenic
1027746997 7:82088825-82088847 AAAGACAATTTTTCCACAAATGG + Intronic
1027889365 7:83950984-83951006 GAAGACAGTTTTTCCACAGACGG + Intergenic
1028057194 7:86261166-86261188 GAAGACAATTTTTCCACGGACGG + Intergenic
1028348668 7:89816421-89816443 GAAGACAATTTTTCCACAGATGG + Intergenic
1028377182 7:90156712-90156734 GAAGACAATTTTTCCAAGTAGGG - Intronic
1028391831 7:90325893-90325915 GAGGACAAGTTTTCCACAGATGG - Intergenic
1029156915 7:98523815-98523837 AAAGACAATTTTTCCACAGATGG + Intergenic
1029954120 7:104619831-104619853 TAAGACAATTATTCCACAGATGG + Intronic
1030139918 7:106293754-106293776 GAAGGCAATTTTTCCACAGTGGG - Intergenic
1030279021 7:107751105-107751127 GAAGACAGTTTTTCCACAGGTGG + Intronic
1030295793 7:107925472-107925494 GAAGACAATTTTTCCAGACTCGG - Intronic
1030387512 7:108883210-108883232 AAAGACCATTTTTCCAAAAAAGG - Intergenic
1030479259 7:110081872-110081894 GAAAACAATTTTTCCATGGATGG + Intergenic
1030810861 7:113970757-113970779 GAAGACAATTTTTCCATATATGG + Intronic
1030900645 7:115119202-115119224 GAAGACAATTTTTCCATAGCCGG - Intergenic
1030948802 7:115763323-115763345 AGAGACAATTTTTCCACGGAAGG + Intergenic
1031011049 7:116525708-116525730 GAAGACGAGGTTTCCACACCCGG - Intronic
1031126081 7:117774631-117774653 GAAGACAATTTTTCCATGGTTGG - Intronic
1031221815 7:118976312-118976334 TAAGACAATTTTTCCACGGACGG + Intergenic
1031306092 7:120129655-120129677 GAAGACACTTTTTCCATGGAAGG - Intergenic
1031371081 7:120967389-120967411 GAACATGATGTTTCCTCAGAAGG - Intronic
1031488828 7:122363217-122363239 GATGAGGCATTTTCCACAGAGGG - Intronic
1031532632 7:122894939-122894961 GAAGACAATTTTTCCACAGACGG + Intergenic
1031945252 7:127832989-127833011 GAAGACAATTTTTACATGGATGG - Intronic
1032058525 7:128704200-128704222 GAAGACAGTCTTTCCACAGATGG + Intergenic
1032073392 7:128823826-128823848 GAAGACAATTTTTCCACAGATGG + Intergenic
1032343246 7:131095256-131095278 GAAGATAATTTTTCCACGGATGG - Intergenic
1032878815 7:136066835-136066857 GAAGACAATTTTTCCACGCACGG + Intergenic
1033135423 7:138780205-138780227 GAAGACAGTTTTTCCACGAATGG + Intronic
1033853104 7:145521969-145521991 AAAGACAATTTTTCCACAGATGG - Intergenic
1034225758 7:149479937-149479959 GAAGACCCTGTCTCCACAGAGGG + Intronic
1034226399 7:149487195-149487217 GAAGACAATTTTTCCACCAATGG - Intronic
1034518316 7:151599540-151599562 GAAGACAATTTTTCCACTGGGGG + Intronic
1034521368 7:151622986-151623008 GAAGACAATTTTTCCATGGATGG + Intronic
1034635149 7:152561319-152561341 GAAGACAATTTTTCCATGGGGGG - Intergenic
1035757052 8:2042508-2042530 GAAGACAATTTTTCCAAGAACGG - Intergenic
1035774091 8:2173952-2173974 GAAGACAATTTTTCCACGGACGG + Intergenic
1036038160 8:5042882-5042904 GAAGACAATTTTTCCATGGATGG + Intergenic
1036402545 8:8423164-8423186 GAAGACAGTTTTTCCACGAACGG + Intergenic
1036445396 8:8817680-8817702 GAAGATGATTTTTCCAGGGATGG + Intronic
1036621917 8:10429802-10429824 AAAGACGATTTTCCCACAAGTGG + Intergenic
1036668428 8:10763702-10763724 GAAGTCACTTTCTCCACAGAGGG - Intronic
1037140914 8:15519681-15519703 GAAGACAATTTTCCCACGGATGG - Intronic
1037376702 8:18238160-18238182 GAAGACAATTTTTCCATGGATGG + Intergenic
1037496260 8:19443859-19443881 GAAGACAATTTTTCCACACTGGG + Intronic
1037603580 8:20419304-20419326 GAAGACAGTTTTTCCATGGATGG + Intergenic
1037742528 8:21618966-21618988 GAAGACAGTTTTTCCACAGATGG - Intergenic
1037799828 8:22026257-22026279 GAAGACAATTTTTGCATGGATGG - Intronic
1038032968 8:23661084-23661106 GAAGACAATTTTTCCACAGATGG + Intergenic
1038195059 8:25359734-25359756 AAAGACAATTTTTCCACGGATGG - Intronic
1038372688 8:27009815-27009837 GAAGACAATTTTTCCACAGATGG - Intergenic
1038387469 8:27162595-27162617 GAAGACAATTTTTCCACATCTGG - Intergenic
1038607664 8:29024976-29024998 GAAGACAATTTTTCCACCGACGG - Intronic
1038696807 8:29813469-29813491 GAAGACAATTTTTCCATGGATGG - Intergenic
1039070690 8:33647019-33647041 GGAGACAATTTTTCCATGGATGG + Intergenic
1039187323 8:34931815-34931837 GAAGACAATTTTTCTACAGAAGG + Intergenic
1039279609 8:35969637-35969659 AAAGACAATTTTTCCACGGTGGG + Intergenic
1039375534 8:37028971-37028993 GAAGACAATTTTTCCATGGAAGG - Intergenic
1039618862 8:38978431-38978453 GAAGACAATTTTTCCACAGACGG - Intronic
1040905268 8:52463359-52463381 GAGGACAATTTTTTCACAGATGG + Intergenic
1041096754 8:54357856-54357878 GCAGACAATTTTTCCATAGCTGG + Intergenic
1041281565 8:56215420-56215442 GAAGACAATTTTTCCACGGATGG + Intronic
1041483125 8:58345143-58345165 GAAGACAAATTTTCCACAGATGG + Intergenic
1041502718 8:58556191-58556213 GAAGACAGTTTTTCCACGGACGG + Intronic
1042378247 8:68081120-68081142 GAAGACAATTTTTCCACAGGCGG + Intronic
1042425428 8:68642802-68642824 GAAGACAATTTTTCCATGGATGG + Intronic
1042910838 8:73824592-73824614 GAAGACAATTTTTCCATGGATGG + Intronic
1042981403 8:74532964-74532986 GAAGACAGTTTTTCCACAGATGG + Intergenic
1043159408 8:76827128-76827150 GAAGACAGTTTTTCCACAGACGG + Intronic
1043187281 8:77170170-77170192 GAAGACAATTTTCCCATGGACGG + Intergenic
1043445223 8:80313039-80313061 GGAGACAATGTTTCCACAAATGG + Intergenic
1043772847 8:84226293-84226315 AAAGACAATTTTTCCATGGATGG - Intronic
1043845933 8:85164182-85164204 GAAGACAGTTTTTCCACAGACGG + Intergenic
1043979114 8:86617826-86617848 GAAGACAATTTTTTCACTGATGG + Intronic
1044136681 8:88594517-88594539 GAAAACAATTTTTCCATGGATGG + Intergenic
1044312628 8:90711669-90711691 CAAGACAGTTTTTCCACAGGTGG + Intronic
1044519047 8:93176558-93176580 GAAGACAATTTTTCCATGGATGG - Intergenic
1044586749 8:93875532-93875554 GAAGACAATTTTTCTAAGGAGGG + Intronic
1044784954 8:95783707-95783729 GAAGACAGTTTTTCCATGGATGG - Intergenic
1045078161 8:98593719-98593741 GAAGACAGTTTTTCCATGGATGG - Intronic
1045090146 8:98733540-98733562 GAAGACAATTTTTCTACGGATGG - Intronic
1045098333 8:98821345-98821367 GGAAACAATTTTTGCACAGATGG - Intronic
1045229780 8:100292956-100292978 GAAGACAATTTTTCCACAGATGG + Intronic
1045290714 8:100830299-100830321 GAAGACAATTTTTCCACCAGTGG - Intergenic
1045401876 8:101827348-101827370 AAAGACCCTTTTTCCACATATGG + Intronic
1045531511 8:102989444-102989466 GAAGACAATTCTTCCACACATGG - Intergenic
1045562230 8:103275748-103275770 GTATAGGATTTTTGCACAGAAGG - Intergenic
1045574972 8:103410572-103410594 GAAGACAATTTTTCCATGAACGG - Intronic
1045946710 8:107804874-107804896 GAATACAGTTTTTCCACAGATGG + Intergenic
1045981889 8:108199493-108199515 GAAGACAAGTTTTCCACGGATGG + Intergenic
1046013089 8:108573966-108573988 GAAGACAATTTCTCCACGGTTGG + Intergenic
1046062679 8:109157967-109157989 GAAGACAATTTTTCTACAGATGG + Intergenic
1046238152 8:111454354-111454376 GAAGACAGTTTTTCCACAGAAGG - Intergenic
1046259710 8:111751479-111751501 GAAGACAATTTTTCCACAGATGG - Intergenic
1046363714 8:113196958-113196980 TAAGAAAATTGTTCCACAGAGGG - Intronic
1046622471 8:116542973-116542995 GAAGACAATTTTTTCACTGGGGG + Intergenic
1046638805 8:116702853-116702875 GAGGACAATTTTTCCATAGAAGG + Intronic
1047340712 8:123977734-123977756 GAAGACTATTTTTCCATGAATGG + Intronic
1047982165 8:130194594-130194616 GAAGACAGTTTTTCTACAGATGG + Intronic
1048159738 8:132004516-132004538 GAAGACAGTTTTTCCAAGGATGG - Intronic
1048231110 8:132642929-132642951 GAAGACCATTTTTCCACGGACGG + Intronic
1048462584 8:134634878-134634900 GAAGATAATTTTTCCACAGATGG + Intronic
1048583443 8:135750145-135750167 GGAGACAATTTTTCCACAGATGG - Intergenic
1048583905 8:135755302-135755324 GAAGACAATTTTTCCAAAACAGG - Intergenic
1048724172 8:137362900-137362922 GAAGATAATTTTTCCACTAATGG + Intergenic
1048938126 8:139373944-139373966 GAAGACAATTTTTCCGTGGATGG - Intergenic
1049255763 8:141612837-141612859 GAAGATAATTTTTCCACGGACGG + Intergenic
1050575779 9:6994002-6994024 GAAGACAGTTTTTCCATGGATGG + Intronic
1050800336 9:9603720-9603742 GAAGGCAACTTTTCCACACATGG - Intronic
1050908880 9:11040769-11040791 GAAGACAATTTTTCCATGGAGGG - Intergenic
1050923901 9:11239858-11239880 GAAGATAGTTGTTCCACAGATGG - Intergenic
1050988922 9:12121127-12121149 GAAGACAATTTTTCCATGTATGG - Intergenic
1051681198 9:19609759-19609781 GAAGACAATTTTTCCATGGGTGG + Intronic
1051837890 9:21361608-21361630 GAAGACAATTCTTGAACAGAAGG - Intergenic
1051845839 9:21450186-21450208 GAAGACAATTCTTGAACAGAAGG + Intergenic
1051967112 9:22842921-22842943 GAAGATAAATTTTCCACAGGTGG + Intergenic
1052189486 9:25642072-25642094 GAAGACAATTTTTCCACAAATGG + Intergenic
1052338698 9:27344158-27344180 GAAGAAGATTTTTACACATAAGG + Intronic
1052349175 9:27440899-27440921 GAAGACAATTTTTCCACAGCAGG + Intronic
1052512104 9:29435075-29435097 GAAGACAATTTTTCCATGGATGG + Intergenic
1052554746 9:29999419-29999441 GAAGACAATTTTTCCACAGATGG - Intergenic
1052783166 9:32801900-32801922 GAAGATAATTTTTCCATGGATGG + Intergenic
1052811406 9:33063801-33063823 GAAGACGATTTTTCCACAGATGG - Intronic
1053273367 9:36765426-36765448 GGAGACGATGTTTCCGCAGATGG - Intergenic
1055283910 9:74707247-74707269 GAAGAGGTTTTTTCCATTGATGG - Intergenic
1055429689 9:76230987-76231009 GAAGGCAATTTTTCTACAAATGG - Intronic
1055446014 9:76383016-76383038 GAAGACAATTTTTTCATGGATGG + Intergenic
1055542361 9:77324932-77324954 GAAGACAATTTTTCCACGGGTGG + Intronic
1055767885 9:79684606-79684628 GAAGACAATTTTTCCATGGACGG - Intronic
1056674694 9:88665344-88665366 GAAGACCATTTTCCCACAAATGG - Intergenic
1056702755 9:88924586-88924608 GAAGACAATTTTTCCACAGCCGG + Intergenic
1056706450 9:88956081-88956103 GAAGACAATTTTTCCACGGAGGG + Intergenic
1057007123 9:91570124-91570146 GAAGACAATTTTCCCACAAACGG + Intronic
1057167170 9:92938060-92938082 GAAGACAGTTTTTCCATGGATGG - Intergenic
1057586605 9:96334139-96334161 GAAGACAATTTTTCCATGAATGG + Intronic
1057597135 9:96424094-96424116 GAAGACAACCTTTCCACAGATGG - Intergenic
1057714091 9:97475414-97475436 GAGGCAGATTTTCCCACAGAAGG - Exonic
1057977587 9:99622672-99622694 GAAGATAATTTTTCCATGGATGG + Intergenic
1057984766 9:99701994-99702016 GAAGACAGTTTTTCCATGGATGG + Intergenic
1058168063 9:101643072-101643094 AAAGGCAATTTTTCCACAGATGG - Intronic
1058344277 9:103941476-103941498 GAAGACAGTTTTTCCATGGATGG - Intergenic
1058529463 9:105891254-105891276 AAAGACGCTTTTTCCAAAAAAGG + Intergenic
1058706681 9:107643337-107643359 AAAGACCCTTTTTCCAAAGAAGG - Intergenic
1058764347 9:108166748-108166770 AAAGCCGACTTTTCTACAGAAGG + Intergenic
1059051622 9:110932833-110932855 GAAGACAATTTTTCCACAGATGG - Intronic
1059079412 9:111232594-111232616 GAAGAGGATTTTTCCATGGATGG - Intergenic
1059151633 9:111954552-111954574 GAAGACAATTTTTCCACAGATGG + Intergenic
1059361846 9:113749665-113749687 GAAGACAATTCTTCCACACATGG - Intergenic
1059473312 9:114523895-114523917 GAAGACTATATTTCCAAATAAGG + Intergenic
1059898378 9:118894245-118894267 AAGGATGATTTTTCCACAGCAGG - Intergenic
1060465066 9:123896417-123896439 GAAGTGGATTTTTCCAGAGAAGG - Intronic
1060605571 9:124910904-124910926 GAAGACAGTTTTTCCACAGATGG - Intronic
1060711042 9:125864373-125864395 GAAGACAATTTTTCCATGAATGG + Intronic
1060874381 9:127070060-127070082 GAAGACAGTTTTTCCACGGATGG + Intronic
1061505264 9:131028257-131028279 GAAGACGATTTTTCCACGAACGG - Intronic
1061844217 9:133377723-133377745 GAAGACAATTTTTCCACAGATGG + Intronic
1203487738 Un_GL000224v1:73126-73148 GAAGACAATTTTTCCACAGATGG - Intergenic
1203500359 Un_KI270741v1:15021-15043 GAAGACAATTTTTCCACAGATGG - Intergenic
1185561271 X:1062209-1062231 GAAGACTGTATTTCCAAAGAAGG + Intergenic
1185837260 X:3356644-3356666 GAAGACAATTGTTCCACGGATGG + Intergenic
1185981537 X:4785286-4785308 GAAGACAATTTTTCCATGGATGG - Intergenic
1186022213 X:5269032-5269054 AAAGACAATTTTTCCACAGTTGG + Intergenic
1186394180 X:9191359-9191381 GAAGACAATTTTTCCATGAATGG - Intergenic
1186673865 X:11795066-11795088 AAAGAAGATATTTCAACAGATGG - Intergenic
1187022072 X:15394014-15394036 GAAGACAATTTTTCCTCAGATGG - Intronic
1187328810 X:18316941-18316963 GAAGACAATTTTCCCATGGATGG - Intronic
1188146981 X:26626143-26626165 GAAGACAATTTTTTCATGGATGG + Intergenic
1188174954 X:26977650-26977672 GAAGACAATTTTTCCATTGTGGG + Intergenic
1188313513 X:28646109-28646131 GAAGACAATTTTTCCATGGACGG + Intronic
1188333804 X:28902972-28902994 GAAGCCAATTTTCCCGCAGACGG - Intronic
1189382627 X:40512759-40512781 GAAGACAGCTTTTCCACAGACGG - Intergenic
1189384933 X:40529474-40529496 GAAGACAGTTTTTCCACGGATGG - Intergenic
1189483915 X:41414485-41414507 GAAGACAAATTTCCCACAGACGG - Intergenic
1189503259 X:41584448-41584470 GAAGACAATTTTTCCACGGATGG + Intronic
1189609712 X:42719101-42719123 GAAGACAATTTTTCCATGGATGG - Intergenic
1190261045 X:48797087-48797109 GAAGACAGTCTTTCCACGGATGG - Intergenic
1190556820 X:51644140-51644162 GAACACAATTTTTCCATGGATGG - Intergenic
1190951557 X:55150278-55150300 GAAGACAATTTTTCCACAGATGG + Intronic
1191034242 X:56007710-56007732 GAAAACGTTTTTTTCAAAGATGG - Intergenic
1191212604 X:57904386-57904408 GAAGACAATTTTTCCACGGATGG + Intergenic
1191716247 X:64195710-64195732 GAAGACAATTTTTCCATGGATGG - Intronic
1192407518 X:70901478-70901500 GAAGACAATTTTTCCACGGATGG + Intronic
1192548701 X:72036099-72036121 GAAGACAATTTTTCCACAGATGG - Intergenic
1192850413 X:74949977-74949999 GAAGACAATTTTTCCATGGACGG - Intergenic
1193313015 X:80030001-80030023 AAAGACAATTTTTCCACGAATGG + Intronic
1193324413 X:80162601-80162623 GAAGATAATTTCTCCACAGATGG - Intergenic
1193794162 X:85852715-85852737 GAAGAGAATTTTTCCACAGACGG - Intergenic
1193932696 X:87575425-87575447 GAAGACAATTTTTCCATGGATGG - Intronic
1194592413 X:95815656-95815678 GAAGACAATATTTCCACGAACGG + Intergenic
1194649061 X:96493166-96493188 GAAGACAATTTTTCCATTGATGG - Intergenic
1194657589 X:96592071-96592093 GAAGACAATTTTTCCTCAGAAGG + Intergenic
1194786219 X:98087304-98087326 CAAGACAATTTTTCCACAAATGG + Intergenic
1195124309 X:101790296-101790318 GAAGACAATTTTTCCACCGATGG - Intergenic
1195556288 X:106228406-106228428 AAAGACAGTTTTTCCGCAGACGG - Intergenic
1195639977 X:107162794-107162816 GAAGACAATTTTTCCACAGATGG + Intronic
1195768870 X:108327333-108327355 GAAGACAATTTTTCCATAGAAGG - Intronic
1195944196 X:110191843-110191865 GAAGACAGTTTTTCCACGGATGG + Intergenic
1196364725 X:114911618-114911640 GAGGACAATGTTTCCACAGATGG + Intergenic
1196679797 X:118458996-118459018 GAAGACAATTTTTCCACGGATGG - Intergenic
1197008186 X:121529382-121529404 AAAGACAATTTTTCTACAGATGG - Intergenic
1197359219 X:125478047-125478069 GAAGATGCTTTTGCCACTGAGGG + Intergenic
1197473756 X:126894764-126894786 GAAGACAATTTTTCCATGGATGG + Intergenic
1197763524 X:130044289-130044311 GAAGACAATTAATCAACAGAGGG - Intronic
1197808845 X:130423162-130423184 GAAGACAATTTTTCCACAAATGG - Intergenic
1197976041 X:132166923-132166945 GAAGACAATTTTTCCATGGATGG - Intergenic
1198270894 X:135055370-135055392 GAAGACAATTTTTCCATGGATGG + Intergenic
1198271301 X:135058773-135058795 GAAGACAATTTTTCCAAGGATGG - Intergenic
1198634111 X:138676590-138676612 GGAGAAAATTTTTCCACGGATGG + Intronic
1200112957 X:153752233-153752255 GAAGATAATTTTTCCATGGATGG - Intergenic
1200254178 X:154570657-154570679 GAAGACGAGTTTTCCACAGACGG + Intergenic
1200263591 X:154633751-154633773 GAAGACGAGTTTTCCACAGACGG - Intergenic
1200841068 Y:7782369-7782391 GAAGGCAGTTTTTCTACAGATGG - Intergenic
1201238907 Y:11938911-11938933 GAAGACAATTGTTCCACTGATGG - Intergenic
1201322110 Y:12710943-12710965 GAAGACAATTTTTCCATCGATGG + Intronic
1201648058 Y:16257605-16257627 GAAGACAATTTTTCGATGGATGG - Intergenic
1201654752 Y:16327696-16327718 GAAGACAATTTTTCGATGGATGG + Intergenic
1202085361 Y:21130965-21130987 GATGAAGATGTTTCCAGAGATGG + Intergenic
1202603454 Y:26618237-26618259 GAAGGCAATTTTTCCATGGACGG + Intergenic