ID: 950624932

View in Genome Browser
Species Human (GRCh38)
Location 3:14238327-14238349
Sequence TTTCCACAGATGGTTGGGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950624927_950624932 -3 Left 950624927 3:14238307-14238329 CCGTCTCATGGAAGACGATTTTT No data
Right 950624932 3:14238327-14238349 TTTCCACAGATGGTTGGGTTGGG No data
950624922_950624932 26 Left 950624922 3:14238278-14238300 CCATCTCCAACATTTTGGGCATC No data
Right 950624932 3:14238327-14238349 TTTCCACAGATGGTTGGGTTGGG No data
950624924_950624932 20 Left 950624924 3:14238284-14238306 CCAACATTTTGGGCATCATGGAC No data
Right 950624932 3:14238327-14238349 TTTCCACAGATGGTTGGGTTGGG No data
950624926_950624932 -2 Left 950624926 3:14238306-14238328 CCCGTCTCATGGAAGACGATTTT No data
Right 950624932 3:14238327-14238349 TTTCCACAGATGGTTGGGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950624932 Original CRISPR TTTCCACAGATGGTTGGGTT GGG Intergenic
No off target data available for this crispr