ID: 950624933

View in Genome Browser
Species Human (GRCh38)
Location 3:14238328-14238350
Sequence TTCCACAGATGGTTGGGTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950624926_950624933 -1 Left 950624926 3:14238306-14238328 CCCGTCTCATGGAAGACGATTTT No data
Right 950624933 3:14238328-14238350 TTCCACAGATGGTTGGGTTGGGG No data
950624927_950624933 -2 Left 950624927 3:14238307-14238329 CCGTCTCATGGAAGACGATTTTT No data
Right 950624933 3:14238328-14238350 TTCCACAGATGGTTGGGTTGGGG No data
950624924_950624933 21 Left 950624924 3:14238284-14238306 CCAACATTTTGGGCATCATGGAC No data
Right 950624933 3:14238328-14238350 TTCCACAGATGGTTGGGTTGGGG No data
950624922_950624933 27 Left 950624922 3:14238278-14238300 CCATCTCCAACATTTTGGGCATC No data
Right 950624933 3:14238328-14238350 TTCCACAGATGGTTGGGTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950624933 Original CRISPR TTCCACAGATGGTTGGGTTG GGG Intergenic
No off target data available for this crispr