ID: 950628026

View in Genome Browser
Species Human (GRCh38)
Location 3:14262623-14262645
Sequence CCACCAGGGATTGCAGAGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950628021_950628026 -1 Left 950628021 3:14262601-14262623 CCTCCATTTTTGCTTTTTATTTC No data
Right 950628026 3:14262623-14262645 CCACCAGGGATTGCAGAGATTGG No data
950628022_950628026 -4 Left 950628022 3:14262604-14262626 CCATTTTTGCTTTTTATTTCCAC No data
Right 950628026 3:14262623-14262645 CCACCAGGGATTGCAGAGATTGG No data
950628020_950628026 9 Left 950628020 3:14262591-14262613 CCTACTAGTGCCTCCATTTTTGC No data
Right 950628026 3:14262623-14262645 CCACCAGGGATTGCAGAGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950628026 Original CRISPR CCACCAGGGATTGCAGAGAT TGG Intergenic
No off target data available for this crispr