ID: 950631053

View in Genome Browser
Species Human (GRCh38)
Location 3:14282222-14282244
Sequence GAGGGGCCACTCCCATGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950631053_950631060 8 Left 950631053 3:14282222-14282244 CCAGCTCATGGGAGTGGCCCCTC No data
Right 950631060 3:14282253-14282275 CCCCTCAGCCTCCCTCATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950631053 Original CRISPR GAGGGGCCACTCCCATGAGC TGG (reversed) Intergenic