ID: 950632234

View in Genome Browser
Species Human (GRCh38)
Location 3:14290150-14290172
Sequence CAGACACAGGATTTTTAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950632234_950632246 23 Left 950632234 3:14290150-14290172 CCTGACTAAAAATCCTGTGTCTG No data
Right 950632246 3:14290196-14290218 CATGCCCTGCCACACTCTCTGGG No data
950632234_950632245 22 Left 950632234 3:14290150-14290172 CCTGACTAAAAATCCTGTGTCTG No data
Right 950632245 3:14290195-14290217 TCATGCCCTGCCACACTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950632234 Original CRISPR CAGACACAGGATTTTTAGTC AGG (reversed) Intergenic
No off target data available for this crispr