ID: 950633269

View in Genome Browser
Species Human (GRCh38)
Location 3:14298104-14298126
Sequence GCCTAGGAATGCCGGCTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950633259_950633269 3 Left 950633259 3:14298078-14298100 CCCTGAACCTCCCTTTCCCAGTT No data
Right 950633269 3:14298104-14298126 GCCTAGGAATGCCGGCTTCCTGG No data
950633263_950633269 -7 Left 950633263 3:14298088-14298110 CCCTTTCCCAGTTTAGGCCTAGG No data
Right 950633269 3:14298104-14298126 GCCTAGGAATGCCGGCTTCCTGG No data
950633262_950633269 -4 Left 950633262 3:14298085-14298107 CCTCCCTTTCCCAGTTTAGGCCT No data
Right 950633269 3:14298104-14298126 GCCTAGGAATGCCGGCTTCCTGG No data
950633260_950633269 2 Left 950633260 3:14298079-14298101 CCTGAACCTCCCTTTCCCAGTTT No data
Right 950633269 3:14298104-14298126 GCCTAGGAATGCCGGCTTCCTGG No data
950633265_950633269 -8 Left 950633265 3:14298089-14298111 CCTTTCCCAGTTTAGGCCTAGGA No data
Right 950633269 3:14298104-14298126 GCCTAGGAATGCCGGCTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950633269 Original CRISPR GCCTAGGAATGCCGGCTTCC TGG Intergenic
No off target data available for this crispr