ID: 950634557

View in Genome Browser
Species Human (GRCh38)
Location 3:14305751-14305773
Sequence TTTTATATACAGATGAATTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950634555_950634557 -9 Left 950634555 3:14305737-14305759 CCCTTTCGAGTCATTTTTATATA No data
Right 950634557 3:14305751-14305773 TTTTATATACAGATGAATTGAGG No data
950634549_950634557 17 Left 950634549 3:14305711-14305733 CCATGCTCCATGCCCAAGCCTGG No data
Right 950634557 3:14305751-14305773 TTTTATATACAGATGAATTGAGG No data
950634553_950634557 4 Left 950634553 3:14305724-14305746 CCAAGCCTGGCATCCCTTTCGAG No data
Right 950634557 3:14305751-14305773 TTTTATATACAGATGAATTGAGG No data
950634552_950634557 5 Left 950634552 3:14305723-14305745 CCCAAGCCTGGCATCCCTTTCGA No data
Right 950634557 3:14305751-14305773 TTTTATATACAGATGAATTGAGG No data
950634551_950634557 10 Left 950634551 3:14305718-14305740 CCATGCCCAAGCCTGGCATCCCT No data
Right 950634557 3:14305751-14305773 TTTTATATACAGATGAATTGAGG No data
950634554_950634557 -1 Left 950634554 3:14305729-14305751 CCTGGCATCCCTTTCGAGTCATT No data
Right 950634557 3:14305751-14305773 TTTTATATACAGATGAATTGAGG No data
950634556_950634557 -10 Left 950634556 3:14305738-14305760 CCTTTCGAGTCATTTTTATATAC No data
Right 950634557 3:14305751-14305773 TTTTATATACAGATGAATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950634557 Original CRISPR TTTTATATACAGATGAATTG AGG Intergenic
No off target data available for this crispr