ID: 950635107

View in Genome Browser
Species Human (GRCh38)
Location 3:14308678-14308700
Sequence CAGCTGCTCCAGGGGCTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950635107_950635115 -2 Left 950635107 3:14308678-14308700 CCCAGGAGCCCCTGGAGCAGCTG No data
Right 950635115 3:14308699-14308721 TGAAGGACACATGTAAGCAGGGG No data
950635107_950635117 2 Left 950635107 3:14308678-14308700 CCCAGGAGCCCCTGGAGCAGCTG No data
Right 950635117 3:14308703-14308725 GGACACATGTAAGCAGGGGGTGG No data
950635107_950635114 -3 Left 950635107 3:14308678-14308700 CCCAGGAGCCCCTGGAGCAGCTG No data
Right 950635114 3:14308698-14308720 CTGAAGGACACATGTAAGCAGGG No data
950635107_950635116 -1 Left 950635107 3:14308678-14308700 CCCAGGAGCCCCTGGAGCAGCTG No data
Right 950635116 3:14308700-14308722 GAAGGACACATGTAAGCAGGGGG No data
950635107_950635113 -4 Left 950635107 3:14308678-14308700 CCCAGGAGCCCCTGGAGCAGCTG No data
Right 950635113 3:14308697-14308719 GCTGAAGGACACATGTAAGCAGG No data
950635107_950635120 7 Left 950635107 3:14308678-14308700 CCCAGGAGCCCCTGGAGCAGCTG No data
Right 950635120 3:14308708-14308730 CATGTAAGCAGGGGGTGGGGAGG No data
950635107_950635122 15 Left 950635107 3:14308678-14308700 CCCAGGAGCCCCTGGAGCAGCTG No data
Right 950635122 3:14308716-14308738 CAGGGGGTGGGGAGGACAAAGGG No data
950635107_950635118 3 Left 950635107 3:14308678-14308700 CCCAGGAGCCCCTGGAGCAGCTG No data
Right 950635118 3:14308704-14308726 GACACATGTAAGCAGGGGGTGGG No data
950635107_950635119 4 Left 950635107 3:14308678-14308700 CCCAGGAGCCCCTGGAGCAGCTG No data
Right 950635119 3:14308705-14308727 ACACATGTAAGCAGGGGGTGGGG No data
950635107_950635123 23 Left 950635107 3:14308678-14308700 CCCAGGAGCCCCTGGAGCAGCTG No data
Right 950635123 3:14308724-14308746 GGGGAGGACAAAGGGATCAGAGG No data
950635107_950635121 14 Left 950635107 3:14308678-14308700 CCCAGGAGCCCCTGGAGCAGCTG No data
Right 950635121 3:14308715-14308737 GCAGGGGGTGGGGAGGACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950635107 Original CRISPR CAGCTGCTCCAGGGGCTCCT GGG (reversed) Intergenic
No off target data available for this crispr