ID: 950635788

View in Genome Browser
Species Human (GRCh38)
Location 3:14313545-14313567
Sequence TCTCACCATCTCTTAAGACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950635783_950635788 16 Left 950635783 3:14313506-14313528 CCTTCCTTCCTCTCCTCCTCAAT No data
Right 950635788 3:14313545-14313567 TCTCACCATCTCTTAAGACCAGG No data
950635787_950635788 0 Left 950635787 3:14313522-14313544 CCTCAATCTCTGCATATTCAAAT No data
Right 950635788 3:14313545-14313567 TCTCACCATCTCTTAAGACCAGG No data
950635785_950635788 8 Left 950635785 3:14313514-14313536 CCTCTCCTCCTCAATCTCTGCAT No data
Right 950635788 3:14313545-14313567 TCTCACCATCTCTTAAGACCAGG No data
950635786_950635788 3 Left 950635786 3:14313519-14313541 CCTCCTCAATCTCTGCATATTCA No data
Right 950635788 3:14313545-14313567 TCTCACCATCTCTTAAGACCAGG No data
950635782_950635788 17 Left 950635782 3:14313505-14313527 CCCTTCCTTCCTCTCCTCCTCAA No data
Right 950635788 3:14313545-14313567 TCTCACCATCTCTTAAGACCAGG No data
950635784_950635788 12 Left 950635784 3:14313510-14313532 CCTTCCTCTCCTCCTCAATCTCT No data
Right 950635788 3:14313545-14313567 TCTCACCATCTCTTAAGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950635788 Original CRISPR TCTCACCATCTCTTAAGACC AGG Intergenic
No off target data available for this crispr