ID: 950638503

View in Genome Browser
Species Human (GRCh38)
Location 3:14332926-14332948
Sequence CAGAAACCTACAATATTTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950638503_950638519 24 Left 950638503 3:14332926-14332948 CCCCAAAATATTGTAGGTTTCTG No data
Right 950638519 3:14332973-14332995 TAGCTGCTTGGTGGTGCCAGTGG No data
950638503_950638510 -1 Left 950638503 3:14332926-14332948 CCCCAAAATATTGTAGGTTTCTG No data
Right 950638510 3:14332948-14332970 GTCCCCACAGGGGCCCAGCTGGG No data
950638503_950638515 12 Left 950638503 3:14332926-14332948 CCCCAAAATATTGTAGGTTTCTG No data
Right 950638515 3:14332961-14332983 CCCAGCTGGGCCTAGCTGCTTGG No data
950638503_950638517 15 Left 950638503 3:14332926-14332948 CCCCAAAATATTGTAGGTTTCTG No data
Right 950638517 3:14332964-14332986 AGCTGGGCCTAGCTGCTTGGTGG No data
950638503_950638522 29 Left 950638503 3:14332926-14332948 CCCCAAAATATTGTAGGTTTCTG No data
Right 950638522 3:14332978-14333000 GCTTGGTGGTGCCAGTGGGTGGG No data
950638503_950638521 28 Left 950638503 3:14332926-14332948 CCCCAAAATATTGTAGGTTTCTG No data
Right 950638521 3:14332977-14332999 TGCTTGGTGGTGCCAGTGGGTGG No data
950638503_950638509 -2 Left 950638503 3:14332926-14332948 CCCCAAAATATTGTAGGTTTCTG No data
Right 950638509 3:14332947-14332969 TGTCCCCACAGGGGCCCAGCTGG No data
950638503_950638520 25 Left 950638503 3:14332926-14332948 CCCCAAAATATTGTAGGTTTCTG No data
Right 950638520 3:14332974-14332996 AGCTGCTTGGTGGTGCCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950638503 Original CRISPR CAGAAACCTACAATATTTTG GGG (reversed) Intergenic