ID: 950638504

View in Genome Browser
Species Human (GRCh38)
Location 3:14332927-14332949
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950638504_950638510 -2 Left 950638504 3:14332927-14332949 CCCAAAATATTGTAGGTTTCTGT No data
Right 950638510 3:14332948-14332970 GTCCCCACAGGGGCCCAGCTGGG No data
950638504_950638522 28 Left 950638504 3:14332927-14332949 CCCAAAATATTGTAGGTTTCTGT No data
Right 950638522 3:14332978-14333000 GCTTGGTGGTGCCAGTGGGTGGG No data
950638504_950638519 23 Left 950638504 3:14332927-14332949 CCCAAAATATTGTAGGTTTCTGT No data
Right 950638519 3:14332973-14332995 TAGCTGCTTGGTGGTGCCAGTGG No data
950638504_950638520 24 Left 950638504 3:14332927-14332949 CCCAAAATATTGTAGGTTTCTGT No data
Right 950638520 3:14332974-14332996 AGCTGCTTGGTGGTGCCAGTGGG No data
950638504_950638515 11 Left 950638504 3:14332927-14332949 CCCAAAATATTGTAGGTTTCTGT No data
Right 950638515 3:14332961-14332983 CCCAGCTGGGCCTAGCTGCTTGG No data
950638504_950638509 -3 Left 950638504 3:14332927-14332949 CCCAAAATATTGTAGGTTTCTGT No data
Right 950638509 3:14332947-14332969 TGTCCCCACAGGGGCCCAGCTGG No data
950638504_950638517 14 Left 950638504 3:14332927-14332949 CCCAAAATATTGTAGGTTTCTGT No data
Right 950638517 3:14332964-14332986 AGCTGGGCCTAGCTGCTTGGTGG No data
950638504_950638521 27 Left 950638504 3:14332927-14332949 CCCAAAATATTGTAGGTTTCTGT No data
Right 950638521 3:14332977-14332999 TGCTTGGTGGTGCCAGTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950638504 Original CRISPR ACAGAAACCTACAATATTTT GGG (reversed) Intergenic