ID: 950638509

View in Genome Browser
Species Human (GRCh38)
Location 3:14332947-14332969
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950638504_950638509 -3 Left 950638504 3:14332927-14332949 CCCAAAATATTGTAGGTTTCTGT No data
Right 950638509 3:14332947-14332969 TGTCCCCACAGGGGCCCAGCTGG No data
950638503_950638509 -2 Left 950638503 3:14332926-14332948 CCCCAAAATATTGTAGGTTTCTG No data
Right 950638509 3:14332947-14332969 TGTCCCCACAGGGGCCCAGCTGG No data
950638505_950638509 -4 Left 950638505 3:14332928-14332950 CCAAAATATTGTAGGTTTCTGTC No data
Right 950638509 3:14332947-14332969 TGTCCCCACAGGGGCCCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type