ID: 950640574

View in Genome Browser
Species Human (GRCh38)
Location 3:14345782-14345804
Sequence GCCAGAGGCCGTGGGATCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950640574_950640582 -8 Left 950640574 3:14345782-14345804 CCCAGGATCCCACGGCCTCTGGC No data
Right 950640582 3:14345797-14345819 CCTCTGGCTTTGGGACAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950640574 Original CRISPR GCCAGAGGCCGTGGGATCCT GGG (reversed) Intergenic
No off target data available for this crispr