ID: 950643100

View in Genome Browser
Species Human (GRCh38)
Location 3:14360918-14360940
Sequence CAGGGTTAGAAATGTGTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950643096_950643100 2 Left 950643096 3:14360893-14360915 CCGTGGAAGTTGAACAGGGGAGT No data
Right 950643100 3:14360918-14360940 CAGGGTTAGAAATGTGTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950643100 Original CRISPR CAGGGTTAGAAATGTGTTCC AGG Intergenic
No off target data available for this crispr