ID: 950643667

View in Genome Browser
Species Human (GRCh38)
Location 3:14364407-14364429
Sequence TAGCAGAACTAGAATTAGAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950643667_950643673 3 Left 950643667 3:14364407-14364429 CCGTTCTAATTCTAGTTCTGCTA No data
Right 950643673 3:14364433-14364455 CCCAGCAGAGTGGCCTTGGGCGG No data
950643667_950643669 -1 Left 950643667 3:14364407-14364429 CCGTTCTAATTCTAGTTCTGCTA No data
Right 950643669 3:14364429-14364451 ACCTCCCAGCAGAGTGGCCTTGG No data
950643667_950643668 -7 Left 950643667 3:14364407-14364429 CCGTTCTAATTCTAGTTCTGCTA No data
Right 950643668 3:14364423-14364445 TCTGCTACCTCCCAGCAGAGTGG No data
950643667_950643675 4 Left 950643667 3:14364407-14364429 CCGTTCTAATTCTAGTTCTGCTA No data
Right 950643675 3:14364434-14364456 CCAGCAGAGTGGCCTTGGGCGGG No data
950643667_950643671 0 Left 950643667 3:14364407-14364429 CCGTTCTAATTCTAGTTCTGCTA No data
Right 950643671 3:14364430-14364452 CCTCCCAGCAGAGTGGCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950643667 Original CRISPR TAGCAGAACTAGAATTAGAA CGG (reversed) Intergenic
No off target data available for this crispr