ID: 950645027

View in Genome Browser
Species Human (GRCh38)
Location 3:14371938-14371960
Sequence GAATCACTTGTCACCGGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950645027_950645033 3 Left 950645027 3:14371938-14371960 CCAGGCCCGGTGACAAGTGATTC No data
Right 950645033 3:14371964-14371986 ATAAGTGCCTCATGCTCTTCCGG No data
950645027_950645034 8 Left 950645027 3:14371938-14371960 CCAGGCCCGGTGACAAGTGATTC No data
Right 950645034 3:14371969-14371991 TGCCTCATGCTCTTCCGGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950645027 Original CRISPR GAATCACTTGTCACCGGGCC TGG (reversed) Intergenic
No off target data available for this crispr