ID: 950646691

View in Genome Browser
Species Human (GRCh38)
Location 3:14381662-14381684
Sequence GGTAATAGGCACCACCACAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950646691_950646706 19 Left 950646691 3:14381662-14381684 CCCCTGTGGTGGTGCCTATTACC No data
Right 950646706 3:14381704-14381726 TCTCTTGGCCAAGAGGAAAGGGG No data
950646691_950646703 12 Left 950646691 3:14381662-14381684 CCCCTGTGGTGGTGCCTATTACC No data
Right 950646703 3:14381697-14381719 TAAGAGTTCTCTTGGCCAAGAGG No data
950646691_950646700 4 Left 950646691 3:14381662-14381684 CCCCTGTGGTGGTGCCTATTACC No data
Right 950646700 3:14381689-14381711 CCCCTAAATAAGAGTTCTCTTGG No data
950646691_950646705 18 Left 950646691 3:14381662-14381684 CCCCTGTGGTGGTGCCTATTACC No data
Right 950646705 3:14381703-14381725 TTCTCTTGGCCAAGAGGAAAGGG No data
950646691_950646708 23 Left 950646691 3:14381662-14381684 CCCCTGTGGTGGTGCCTATTACC No data
Right 950646708 3:14381708-14381730 TTGGCCAAGAGGAAAGGGGGCGG No data
950646691_950646704 17 Left 950646691 3:14381662-14381684 CCCCTGTGGTGGTGCCTATTACC No data
Right 950646704 3:14381702-14381724 GTTCTCTTGGCCAAGAGGAAAGG No data
950646691_950646710 30 Left 950646691 3:14381662-14381684 CCCCTGTGGTGGTGCCTATTACC No data
Right 950646710 3:14381715-14381737 AGAGGAAAGGGGGCGGCCACTGG No data
950646691_950646707 20 Left 950646691 3:14381662-14381684 CCCCTGTGGTGGTGCCTATTACC No data
Right 950646707 3:14381705-14381727 CTCTTGGCCAAGAGGAAAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950646691 Original CRISPR GGTAATAGGCACCACCACAG GGG (reversed) Intergenic
No off target data available for this crispr