ID: 950646694

View in Genome Browser
Species Human (GRCh38)
Location 3:14381676-14381698
Sequence TATTTAGGGGGAGGGGTAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950646694_950646700 -10 Left 950646694 3:14381676-14381698 CCTATTACCCCTCCCCCTAAATA No data
Right 950646700 3:14381689-14381711 CCCCTAAATAAGAGTTCTCTTGG No data
950646694_950646707 6 Left 950646694 3:14381676-14381698 CCTATTACCCCTCCCCCTAAATA No data
Right 950646707 3:14381705-14381727 CTCTTGGCCAAGAGGAAAGGGGG No data
950646694_950646705 4 Left 950646694 3:14381676-14381698 CCTATTACCCCTCCCCCTAAATA No data
Right 950646705 3:14381703-14381725 TTCTCTTGGCCAAGAGGAAAGGG No data
950646694_950646708 9 Left 950646694 3:14381676-14381698 CCTATTACCCCTCCCCCTAAATA No data
Right 950646708 3:14381708-14381730 TTGGCCAAGAGGAAAGGGGGCGG No data
950646694_950646704 3 Left 950646694 3:14381676-14381698 CCTATTACCCCTCCCCCTAAATA No data
Right 950646704 3:14381702-14381724 GTTCTCTTGGCCAAGAGGAAAGG No data
950646694_950646710 16 Left 950646694 3:14381676-14381698 CCTATTACCCCTCCCCCTAAATA No data
Right 950646710 3:14381715-14381737 AGAGGAAAGGGGGCGGCCACTGG No data
950646694_950646706 5 Left 950646694 3:14381676-14381698 CCTATTACCCCTCCCCCTAAATA No data
Right 950646706 3:14381704-14381726 TCTCTTGGCCAAGAGGAAAGGGG No data
950646694_950646711 25 Left 950646694 3:14381676-14381698 CCTATTACCCCTCCCCCTAAATA No data
Right 950646711 3:14381724-14381746 GGGGCGGCCACTGGAAGACAAGG No data
950646694_950646712 30 Left 950646694 3:14381676-14381698 CCTATTACCCCTCCCCCTAAATA No data
Right 950646712 3:14381729-14381751 GGCCACTGGAAGACAAGGCCAGG No data
950646694_950646703 -2 Left 950646694 3:14381676-14381698 CCTATTACCCCTCCCCCTAAATA No data
Right 950646703 3:14381697-14381719 TAAGAGTTCTCTTGGCCAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950646694 Original CRISPR TATTTAGGGGGAGGGGTAAT AGG (reversed) Intergenic
No off target data available for this crispr