ID: 950646701

View in Genome Browser
Species Human (GRCh38)
Location 3:14381690-14381712
Sequence GCCAAGAGAACTCTTATTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950646701_950646710 2 Left 950646701 3:14381690-14381712 CCCTAAATAAGAGTTCTCTTGGC No data
Right 950646710 3:14381715-14381737 AGAGGAAAGGGGGCGGCCACTGG No data
950646701_950646707 -8 Left 950646701 3:14381690-14381712 CCCTAAATAAGAGTTCTCTTGGC No data
Right 950646707 3:14381705-14381727 CTCTTGGCCAAGAGGAAAGGGGG No data
950646701_950646706 -9 Left 950646701 3:14381690-14381712 CCCTAAATAAGAGTTCTCTTGGC No data
Right 950646706 3:14381704-14381726 TCTCTTGGCCAAGAGGAAAGGGG No data
950646701_950646708 -5 Left 950646701 3:14381690-14381712 CCCTAAATAAGAGTTCTCTTGGC No data
Right 950646708 3:14381708-14381730 TTGGCCAAGAGGAAAGGGGGCGG No data
950646701_950646716 21 Left 950646701 3:14381690-14381712 CCCTAAATAAGAGTTCTCTTGGC No data
Right 950646716 3:14381734-14381756 CTGGAAGACAAGGCCAGGGGTGG No data
950646701_950646713 17 Left 950646701 3:14381690-14381712 CCCTAAATAAGAGTTCTCTTGGC No data
Right 950646713 3:14381730-14381752 GCCACTGGAAGACAAGGCCAGGG No data
950646701_950646715 18 Left 950646701 3:14381690-14381712 CCCTAAATAAGAGTTCTCTTGGC No data
Right 950646715 3:14381731-14381753 CCACTGGAAGACAAGGCCAGGGG No data
950646701_950646712 16 Left 950646701 3:14381690-14381712 CCCTAAATAAGAGTTCTCTTGGC No data
Right 950646712 3:14381729-14381751 GGCCACTGGAAGACAAGGCCAGG No data
950646701_950646711 11 Left 950646701 3:14381690-14381712 CCCTAAATAAGAGTTCTCTTGGC No data
Right 950646711 3:14381724-14381746 GGGGCGGCCACTGGAAGACAAGG No data
950646701_950646705 -10 Left 950646701 3:14381690-14381712 CCCTAAATAAGAGTTCTCTTGGC No data
Right 950646705 3:14381703-14381725 TTCTCTTGGCCAAGAGGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950646701 Original CRISPR GCCAAGAGAACTCTTATTTA GGG (reversed) Intergenic
No off target data available for this crispr