ID: 950646702

View in Genome Browser
Species Human (GRCh38)
Location 3:14381691-14381713
Sequence GGCCAAGAGAACTCTTATTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950646702_950646711 10 Left 950646702 3:14381691-14381713 CCTAAATAAGAGTTCTCTTGGCC No data
Right 950646711 3:14381724-14381746 GGGGCGGCCACTGGAAGACAAGG No data
950646702_950646707 -9 Left 950646702 3:14381691-14381713 CCTAAATAAGAGTTCTCTTGGCC No data
Right 950646707 3:14381705-14381727 CTCTTGGCCAAGAGGAAAGGGGG No data
950646702_950646716 20 Left 950646702 3:14381691-14381713 CCTAAATAAGAGTTCTCTTGGCC No data
Right 950646716 3:14381734-14381756 CTGGAAGACAAGGCCAGGGGTGG No data
950646702_950646713 16 Left 950646702 3:14381691-14381713 CCTAAATAAGAGTTCTCTTGGCC No data
Right 950646713 3:14381730-14381752 GCCACTGGAAGACAAGGCCAGGG No data
950646702_950646715 17 Left 950646702 3:14381691-14381713 CCTAAATAAGAGTTCTCTTGGCC No data
Right 950646715 3:14381731-14381753 CCACTGGAAGACAAGGCCAGGGG No data
950646702_950646708 -6 Left 950646702 3:14381691-14381713 CCTAAATAAGAGTTCTCTTGGCC No data
Right 950646708 3:14381708-14381730 TTGGCCAAGAGGAAAGGGGGCGG No data
950646702_950646710 1 Left 950646702 3:14381691-14381713 CCTAAATAAGAGTTCTCTTGGCC No data
Right 950646710 3:14381715-14381737 AGAGGAAAGGGGGCGGCCACTGG No data
950646702_950646706 -10 Left 950646702 3:14381691-14381713 CCTAAATAAGAGTTCTCTTGGCC No data
Right 950646706 3:14381704-14381726 TCTCTTGGCCAAGAGGAAAGGGG No data
950646702_950646712 15 Left 950646702 3:14381691-14381713 CCTAAATAAGAGTTCTCTTGGCC No data
Right 950646712 3:14381729-14381751 GGCCACTGGAAGACAAGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950646702 Original CRISPR GGCCAAGAGAACTCTTATTT AGG (reversed) Intergenic
No off target data available for this crispr