ID: 950646708

View in Genome Browser
Species Human (GRCh38)
Location 3:14381708-14381730
Sequence TTGGCCAAGAGGAAAGGGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950646691_950646708 23 Left 950646691 3:14381662-14381684 CCCCTGTGGTGGTGCCTATTACC No data
Right 950646708 3:14381708-14381730 TTGGCCAAGAGGAAAGGGGGCGG No data
950646693_950646708 21 Left 950646693 3:14381664-14381686 CCTGTGGTGGTGCCTATTACCCC No data
Right 950646708 3:14381708-14381730 TTGGCCAAGAGGAAAGGGGGCGG No data
950646699_950646708 -4 Left 950646699 3:14381689-14381711 CCCCTAAATAAGAGTTCTCTTGG No data
Right 950646708 3:14381708-14381730 TTGGCCAAGAGGAAAGGGGGCGG No data
950646697_950646708 0 Left 950646697 3:14381685-14381707 CCTCCCCCTAAATAAGAGTTCTC No data
Right 950646708 3:14381708-14381730 TTGGCCAAGAGGAAAGGGGGCGG No data
950646698_950646708 -3 Left 950646698 3:14381688-14381710 CCCCCTAAATAAGAGTTCTCTTG No data
Right 950646708 3:14381708-14381730 TTGGCCAAGAGGAAAGGGGGCGG No data
950646694_950646708 9 Left 950646694 3:14381676-14381698 CCTATTACCCCTCCCCCTAAATA No data
Right 950646708 3:14381708-14381730 TTGGCCAAGAGGAAAGGGGGCGG No data
950646696_950646708 1 Left 950646696 3:14381684-14381706 CCCTCCCCCTAAATAAGAGTTCT No data
Right 950646708 3:14381708-14381730 TTGGCCAAGAGGAAAGGGGGCGG No data
950646695_950646708 2 Left 950646695 3:14381683-14381705 CCCCTCCCCCTAAATAAGAGTTC No data
Right 950646708 3:14381708-14381730 TTGGCCAAGAGGAAAGGGGGCGG No data
950646701_950646708 -5 Left 950646701 3:14381690-14381712 CCCTAAATAAGAGTTCTCTTGGC No data
Right 950646708 3:14381708-14381730 TTGGCCAAGAGGAAAGGGGGCGG No data
950646702_950646708 -6 Left 950646702 3:14381691-14381713 CCTAAATAAGAGTTCTCTTGGCC No data
Right 950646708 3:14381708-14381730 TTGGCCAAGAGGAAAGGGGGCGG No data
950646692_950646708 22 Left 950646692 3:14381663-14381685 CCCTGTGGTGGTGCCTATTACCC No data
Right 950646708 3:14381708-14381730 TTGGCCAAGAGGAAAGGGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950646708 Original CRISPR TTGGCCAAGAGGAAAGGGGG CGG Intergenic
No off target data available for this crispr