ID: 950648418

View in Genome Browser
Species Human (GRCh38)
Location 3:14392338-14392360
Sequence TTCCCAGAGGGGCCCTCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950648413_950648418 -10 Left 950648413 3:14392325-14392347 CCATGCCTATGGGTTCCCAGAGG No data
Right 950648418 3:14392338-14392360 TTCCCAGAGGGGCCCTCCTGTGG No data
950648408_950648418 5 Left 950648408 3:14392310-14392332 CCCAGACAGAGGAGCCCATGCCT No data
Right 950648418 3:14392338-14392360 TTCCCAGAGGGGCCCTCCTGTGG No data
950648406_950648418 13 Left 950648406 3:14392302-14392324 CCTTAGGCCCCAGACAGAGGAGC No data
Right 950648418 3:14392338-14392360 TTCCCAGAGGGGCCCTCCTGTGG No data
950648405_950648418 14 Left 950648405 3:14392301-14392323 CCCTTAGGCCCCAGACAGAGGAG No data
Right 950648418 3:14392338-14392360 TTCCCAGAGGGGCCCTCCTGTGG No data
950648409_950648418 4 Left 950648409 3:14392311-14392333 CCAGACAGAGGAGCCCATGCCTA No data
Right 950648418 3:14392338-14392360 TTCCCAGAGGGGCCCTCCTGTGG No data
950648407_950648418 6 Left 950648407 3:14392309-14392331 CCCCAGACAGAGGAGCCCATGCC No data
Right 950648418 3:14392338-14392360 TTCCCAGAGGGGCCCTCCTGTGG No data
950648412_950648418 -9 Left 950648412 3:14392324-14392346 CCCATGCCTATGGGTTCCCAGAG No data
Right 950648418 3:14392338-14392360 TTCCCAGAGGGGCCCTCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950648418 Original CRISPR TTCCCAGAGGGGCCCTCCTG TGG Intergenic
No off target data available for this crispr