ID: 950648764

View in Genome Browser
Species Human (GRCh38)
Location 3:14394073-14394095
Sequence AGCTTTATTTTAAACAACGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950648761_950648764 10 Left 950648761 3:14394040-14394062 CCGGCACTGATGAGACATTCACG No data
Right 950648764 3:14394073-14394095 AGCTTTATTTTAAACAACGAAGG No data
950648760_950648764 26 Left 950648760 3:14394024-14394046 CCTCTAGCTCAAGGATCCGGCAC No data
Right 950648764 3:14394073-14394095 AGCTTTATTTTAAACAACGAAGG No data
950648759_950648764 27 Left 950648759 3:14394023-14394045 CCCTCTAGCTCAAGGATCCGGCA No data
Right 950648764 3:14394073-14394095 AGCTTTATTTTAAACAACGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950648764 Original CRISPR AGCTTTATTTTAAACAACGA AGG Intergenic
No off target data available for this crispr