ID: 950649572

View in Genome Browser
Species Human (GRCh38)
Location 3:14398844-14398866
Sequence GGGTGCACAAAGTGCATCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950649564_950649572 9 Left 950649564 3:14398812-14398834 CCTTGGTACTCACAGTTATCTTT No data
Right 950649572 3:14398844-14398866 GGGTGCACAAAGTGCATCATGGG No data
950649562_950649572 16 Left 950649562 3:14398805-14398827 CCATTTCCCTTGGTACTCACAGT No data
Right 950649572 3:14398844-14398866 GGGTGCACAAAGTGCATCATGGG No data
950649560_950649572 26 Left 950649560 3:14398795-14398817 CCAAAGCTTTCCATTTCCCTTGG No data
Right 950649572 3:14398844-14398866 GGGTGCACAAAGTGCATCATGGG No data
950649563_950649572 10 Left 950649563 3:14398811-14398833 CCCTTGGTACTCACAGTTATCTT No data
Right 950649572 3:14398844-14398866 GGGTGCACAAAGTGCATCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950649572 Original CRISPR GGGTGCACAAAGTGCATCAT GGG Intergenic
No off target data available for this crispr