ID: 950650938

View in Genome Browser
Species Human (GRCh38)
Location 3:14406267-14406289
Sequence ACCTATAATCAACACTTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 101}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950650938_950650948 23 Left 950650938 3:14406267-14406289 CCTCCCAAGTGTTGATTATAGGT 0: 1
1: 0
2: 0
3: 5
4: 101
Right 950650948 3:14406313-14406335 GGCCTTGAATGCTGTGTAAGTGG 0: 1
1: 0
2: 4
3: 22
4: 128
950650938_950650943 2 Left 950650938 3:14406267-14406289 CCTCCCAAGTGTTGATTATAGGT 0: 1
1: 0
2: 0
3: 5
4: 101
Right 950650943 3:14406292-14406314 GAGCCACCGTGCCAGCCGGAGGG 0: 1
1: 0
2: 6
3: 96
4: 685
950650938_950650952 30 Left 950650938 3:14406267-14406289 CCTCCCAAGTGTTGATTATAGGT 0: 1
1: 0
2: 0
3: 5
4: 101
Right 950650952 3:14406320-14406342 AATGCTGTGTAAGTGGGTTTGGG 0: 1
1: 0
2: 2
3: 17
4: 185
950650938_950650949 24 Left 950650938 3:14406267-14406289 CCTCCCAAGTGTTGATTATAGGT 0: 1
1: 0
2: 0
3: 5
4: 101
Right 950650949 3:14406314-14406336 GCCTTGAATGCTGTGTAAGTGGG 0: 1
1: 0
2: 2
3: 5
4: 107
950650938_950650941 -2 Left 950650938 3:14406267-14406289 CCTCCCAAGTGTTGATTATAGGT 0: 1
1: 0
2: 0
3: 5
4: 101
Right 950650941 3:14406288-14406310 GTGTGAGCCACCGTGCCAGCCGG 0: 3
1: 10
2: 84
3: 377
4: 948
950650938_950650951 29 Left 950650938 3:14406267-14406289 CCTCCCAAGTGTTGATTATAGGT 0: 1
1: 0
2: 0
3: 5
4: 101
Right 950650951 3:14406319-14406341 GAATGCTGTGTAAGTGGGTTTGG 0: 1
1: 0
2: 2
3: 14
4: 144
950650938_950650942 1 Left 950650938 3:14406267-14406289 CCTCCCAAGTGTTGATTATAGGT 0: 1
1: 0
2: 0
3: 5
4: 101
Right 950650942 3:14406291-14406313 TGAGCCACCGTGCCAGCCGGAGG 0: 1
1: 0
2: 21
3: 286
4: 2223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950650938 Original CRISPR ACCTATAATCAACACTTGGG AGG (reversed) Intronic
911612386 1:99970931-99970953 AGATAGAATCAACAGTTGGGAGG - Intronic
912960707 1:114192974-114192996 ACCTAGAATAAATGCTTGGGGGG - Intergenic
917120124 1:171638351-171638373 TCCTATCACCCACACTTGGGAGG - Intronic
922402914 1:225279128-225279150 ACCTGTAATCCCTACTTGGGAGG - Intronic
1069771138 10:70901300-70901322 ATATACAATCTACACTTGGGGGG + Intergenic
1070020800 10:72583535-72583557 ACCTGTAATCATGCCTTGGGAGG - Intronic
1070099975 10:73376301-73376323 AATAATAATCAAAACTTGGGGGG + Intronic
1075913090 10:126142679-126142701 ACCTAAAATCCATACATGGGCGG + Intronic
1085922852 11:80979828-80979850 AGCTATAATCAACACATTGAAGG + Intergenic
1088273843 11:108063467-108063489 ACTTATAATCAAGATTTGGAAGG - Intronic
1090696686 11:129251667-129251689 ACCTATAATCCCAGCTTGGGAGG + Intronic
1093455433 12:19360480-19360502 GCCTGTAATCACTACTTGGGAGG + Intronic
1096144923 12:49272085-49272107 GCCTGTAATCAACACTTTGGGGG - Intronic
1096254723 12:50056121-50056143 ACTTAGAATCAACTCGTGGGGGG - Intergenic
1099801529 12:87463016-87463038 ACCTGAAATCAAGATTTGGGAGG + Intergenic
1100473025 12:94910622-94910644 ACCTGTAATCCCTACTTGGGAGG + Intronic
1102243985 12:111343368-111343390 CCCTGTAAAGAACACTTGGGGGG + Intronic
1103021804 12:117540243-117540265 TTCTTTAATAAACACTTGGGAGG - Intronic
1103077725 12:117998039-117998061 GCCTATAATCCCTACTTGGGAGG + Intergenic
1108854247 13:54773998-54774020 ACCTAAAATCAGCAGTTGGAGGG + Intergenic
1112265946 13:97923611-97923633 GCCTGAAATCAACACTTGGGAGG + Intergenic
1115432065 14:33330476-33330498 GCACATAATAAACACTTGGGAGG + Intronic
1122915789 14:104858078-104858100 GCCTATAACCAGCACTTTGGAGG - Intergenic
1124919039 15:34006634-34006656 GCCTATTATAAACACTTGGCAGG - Intronic
1133394450 16:5435016-5435038 ATCTATAAACAAAGCTTGGGTGG - Intergenic
1135221448 16:20617636-20617658 ACTGATATTCAACACTGGGGAGG + Intronic
1138364277 16:56461101-56461123 CCATTTAATGAACACTTGGGTGG - Intronic
1141352055 16:83307056-83307078 ACATATAAGCTACAGTTGGGTGG + Intronic
1141647858 16:85377029-85377051 ACCAAAAATCAACACGTGGTCGG - Intergenic
1145919644 17:28600629-28600651 ACCTATAATCCCAGCTTGGGAGG + Intronic
1146520891 17:33524723-33524745 ACAAATAAATAACACTTGGGAGG - Intronic
1152143692 17:78554313-78554335 ACCTGTAATCCCTACTTGGGAGG + Intronic
1153111259 18:1590956-1590978 ACTTATAATCACCACTTGCATGG + Intergenic
1153837524 18:8977281-8977303 ACCTGTAATCAACAGAAGGGAGG + Intergenic
1156819093 18:41349896-41349918 ACCCATCACCAAAACTTGGGAGG - Intergenic
1160109059 18:76007751-76007773 CCCTAAAAGCAACACTTGGCAGG - Intergenic
1165271644 19:34712641-34712663 ATCCATGATCAACACTTGGATGG - Intergenic
931312315 2:61093869-61093891 ACCTATAATAAACCCTTTTGTGG + Intronic
931427972 2:62188428-62188450 ACCTATGGTCAACAATTTGGAGG - Intergenic
935053135 2:99541204-99541226 ACCTAAAATCTTCACTTTGGGGG - Intergenic
936610656 2:113999070-113999092 ACCCATAATCAACACATCAGTGG - Intergenic
939326774 2:140701467-140701489 ACCTATAATCAAGACATGCCAGG + Intronic
939464557 2:142540916-142540938 ACCTCTAAACAACATTTGAGAGG + Intergenic
940858791 2:158751270-158751292 ACCTAGAATCAACACTGAGCAGG - Intergenic
941033184 2:160536380-160536402 ACCTATAATCAAGCACTGGGTGG + Intergenic
944163912 2:196696571-196696593 ACCTGTAATCAAGACATGGTAGG - Intronic
944492681 2:200273860-200273882 ACCTATCAACAACACATGGTGGG - Intergenic
944925506 2:204459954-204459976 AAATATATTCTACACTTGGGGGG - Intergenic
945029731 2:205652101-205652123 ACCTATATTCAACATTTGTAGGG - Intergenic
946700888 2:222411928-222411950 ACCCATAATCTACCCATGGGAGG - Intergenic
1170656389 20:18290867-18290889 ACCTGTAATCAGCACTTTGGGGG + Intronic
1173695758 20:45010363-45010385 ACATATAATAAATAATTGGGAGG - Intronic
1177470985 21:21560643-21560665 ACCTATAATCACTACTCAGGAGG - Intergenic
1181665071 22:24389370-24389392 ATCTGTAATCAGCACTTTGGGGG - Intronic
1185226105 22:49653766-49653788 ACCTGTAATCCCAACTTGGGAGG - Intronic
950650938 3:14406267-14406289 ACCTATAATCAACACTTGGGAGG - Intronic
951596645 3:24325915-24325937 ACCTATTTTCAACACTTAGCAGG - Intronic
953064752 3:39458744-39458766 ACCTATCAGCAACATGTGGGTGG - Intergenic
959996544 3:112686782-112686804 AGTTATTATGAACACTTGGGTGG + Intergenic
965541657 3:169877653-169877675 ACCTACCATCAACAGCTGGGTGG - Intergenic
968344090 3:197985870-197985892 ACCTATAATTAAAAGGTGGGAGG - Exonic
974858737 4:67493758-67493780 TCCTATTATCAAAATTTGGGGGG + Intronic
975176734 4:71298127-71298149 AACAATAATCAACATTTGTGTGG - Intronic
976314850 4:83648403-83648425 ACATAAAATCAATACATGGGAGG + Intergenic
986707453 5:10463588-10463610 AACCATAACCAGCACTTGGGGGG - Intronic
989298138 5:39854006-39854028 ACCTATTTCCAACACTTGGCCGG - Intergenic
991903204 5:71480686-71480708 ACCTGTAATCCCAACTTGGGAGG - Intronic
994405211 5:99336889-99336911 TCCTATAAGCAGCACTTGGTTGG - Intergenic
996625348 5:125564036-125564058 ACTTACAATCAACACAGGGGAGG + Intergenic
1002411615 5:179083212-179083234 ACCTATAAGAGACATTTGGGGGG + Exonic
1003882693 6:10492911-10492933 ACCTGTAATCCATACTTGGGAGG - Intronic
1007877141 6:45117235-45117257 TCCAATAATCAACACTTTGTGGG + Intronic
1013037751 6:106403074-106403096 ACCTGTAATCACGCCTTGGGAGG + Intergenic
1015376438 6:132515392-132515414 ACATATGAACAACACTTAGGAGG - Intergenic
1016697499 6:147015201-147015223 GCCTATAATCCCTACTTGGGAGG + Intergenic
1016971750 6:149770448-149770470 ACCTATAATCCAGCTTTGGGAGG + Intronic
1017161354 6:151368882-151368904 ACCTGTAATCCCAACTTGGGAGG - Intronic
1017649709 6:156569846-156569868 ACTTATAATCAGCACTTCAGAGG - Intergenic
1018860259 6:167706242-167706264 AACTATTATTAACACTTGGCAGG - Intergenic
1020853857 7:13392106-13392128 ACATATAATGAACCTTTGGGTGG + Intergenic
1023884033 7:44338958-44338980 ACCGATAATGAACACCAGGGTGG + Intergenic
1023975666 7:45028020-45028042 ACCTATACTCCCCACCTGGGTGG - Intronic
1024162986 7:46698360-46698382 AACTATAATCCCCACTTGTGGGG + Intronic
1026641054 7:72125922-72125944 GCCTATAATCCCTACTTGGGAGG - Intronic
1027541486 7:79472223-79472245 ACTTATAAGCAATGCTTGGGAGG + Intergenic
1032118222 7:129135600-129135622 ACATATAATAAACACTTTGTGGG + Intergenic
1032606601 7:133361534-133361556 AAATTTAATCAACACTCGGGAGG - Intronic
1035061411 7:156072155-156072177 TCCTAATATCATCACTTGGGAGG - Intergenic
1035454020 7:158997379-158997401 CCCAAAAGTCAACACTTGGGAGG - Intergenic
1039424581 8:37475610-37475632 ACCTGTAATAAACACTAGGCAGG + Intergenic
1041025107 8:53676443-53676465 ACCTGTAATCCCAACTTGGGAGG + Intergenic
1044213646 8:89581433-89581455 ACCTGTAATCACTACTTTGGAGG - Intergenic
1050021814 9:1292283-1292305 ACCTATAATCAGCAATGGGGAGG - Intergenic
1053205371 9:36181839-36181861 CTCTATAGACAACACTTGGGAGG + Intergenic
1053310640 9:37016728-37016750 ACCTATCATCAACTCTTGTTAGG - Intronic
1053624165 9:39851796-39851818 ACCTATAGTCAAGTTTTGGGTGG + Intergenic
1053880701 9:42591432-42591454 ACCTATAGTCAAGTTTTGGGTGG - Intergenic
1053891969 9:42702900-42702922 ACCTATAGTCAAGTTTTGGGTGG + Intergenic
1054219732 9:62398902-62398924 ACCTATAGTCAAGTTTTGGGTGG - Intergenic
1054230983 9:62510271-62510293 ACCTATAGTCAAGTTTTGGGTGG + Intergenic
1056310558 9:85336873-85336895 AGCTAGAATTAACACTTGGAAGG + Intergenic
1059332957 9:113548014-113548036 GCCTGTAATCAATACTTAGGTGG + Intronic
1197140743 X:123114968-123114990 ATCTATAATAATCTCTTGGGGGG - Intergenic
1197557342 X:127972154-127972176 GCCTGTAATCATCACTTGAGTGG + Intergenic
1198059736 X:133033131-133033153 ACCTTTAACCCAAACTTGGGAGG - Intronic
1199159581 X:144592849-144592871 ACCAATAATAAATACTTGAGGGG - Intergenic
1200354269 X:155531710-155531732 ACCTCTGATCAATACTTGGCTGG + Intronic