ID: 950657871

View in Genome Browser
Species Human (GRCh38)
Location 3:14448434-14448456
Sequence GGGTTTGGCCGGCTATTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 91}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950657867_950657871 -7 Left 950657867 3:14448418-14448440 CCGGGTAGCTCTTCTGGGGTTTG 0: 1
1: 0
2: 1
3: 14
4: 133
Right 950657871 3:14448434-14448456 GGGTTTGGCCGGCTATTGGCTGG 0: 1
1: 0
2: 1
3: 8
4: 91
950657866_950657871 -4 Left 950657866 3:14448415-14448437 CCTCCGGGTAGCTCTTCTGGGGT 0: 1
1: 0
2: 0
3: 3
4: 77
Right 950657871 3:14448434-14448456 GGGTTTGGCCGGCTATTGGCTGG 0: 1
1: 0
2: 1
3: 8
4: 91
950657858_950657871 25 Left 950657858 3:14448386-14448408 CCTCCACGTGTCTGCAGGCAACT 0: 1
1: 0
2: 0
3: 8
4: 115
Right 950657871 3:14448434-14448456 GGGTTTGGCCGGCTATTGGCTGG 0: 1
1: 0
2: 1
3: 8
4: 91
950657859_950657871 22 Left 950657859 3:14448389-14448411 CCACGTGTCTGCAGGCAACTGTA 0: 1
1: 0
2: 0
3: 4
4: 105
Right 950657871 3:14448434-14448456 GGGTTTGGCCGGCTATTGGCTGG 0: 1
1: 0
2: 1
3: 8
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950657871 Original CRISPR GGGTTTGGCCGGCTATTGGC TGG Intronic
901421046 1:9151483-9151505 TGGTGTGGGCGGCTTTTGGCTGG - Intergenic
902478659 1:16700688-16700710 GGGTTCGGCCTGGGATTGGCGGG - Intergenic
902748494 1:18489812-18489834 GGGTTTGGCTGGCTGTTGACTGG - Intergenic
903760419 1:25694136-25694158 GGGTTTGGCTGGGTAAGGGCTGG + Intronic
905965421 1:42090118-42090140 GTTTTTGGCTGGCTGTTGGCTGG - Intergenic
907633374 1:56107013-56107035 GGGTTTCTCAGGCAATTGGCAGG - Intergenic
908886120 1:68790934-68790956 GAATTTTGCTGGCTATTGGCTGG + Intergenic
919326645 1:196115826-196115848 GTGTTTGGCAGGCTATCAGCTGG + Intergenic
922939338 1:229447961-229447983 GGGTTTTGGCGGGTTTTGGCTGG - Intronic
1064008379 10:11715584-11715606 GGGTTTGGAGGGCACTTGGCAGG + Intergenic
1068734942 10:60402759-60402781 GGGCTTGGCTGGCTGTTGTCTGG - Intronic
1073135763 10:101219229-101219251 GAGTTTGCCCGGCTATTTGGCGG - Intergenic
1074216831 10:111393546-111393568 GGGTCTGGCCGGCTGTGAGCAGG - Intergenic
1076180418 10:128402763-128402785 GTTTTTGGCTGGCTATTGGCTGG + Intergenic
1078900389 11:15636796-15636818 GGGATTAGCTGGCTATTGGTGGG + Intergenic
1081773628 11:45664259-45664281 GGCTTGGGCCGGCCATTGACAGG - Intronic
1085151797 11:74258241-74258263 GGTTTTGCCTGGCTATGGGCTGG - Intronic
1085349131 11:75787331-75787353 GGGCTTGGCCAGCAAGTGGCAGG + Intronic
1085427204 11:76415207-76415229 GGGGCTGGCTGGCTATTGGCTGG + Intergenic
1087027219 11:93661608-93661630 GGTTTGGTCCGGCCATTGGCGGG + Intergenic
1091400009 12:175828-175850 GGCATTGGCCGGGTATTAGCTGG - Exonic
1091941105 12:4483216-4483238 GGGGTTGGCTGGCTGTAGGCTGG - Intergenic
1099496470 12:83353048-83353070 GTGTTTTTCAGGCTATTGGCTGG + Intergenic
1099673644 12:85728643-85728665 GGTTTTTGCTGGCTATTGGCAGG + Intergenic
1102629942 12:114269275-114269297 GGGGGTGGCTGGCTGTTGGCTGG + Intergenic
1103925264 12:124420424-124420446 GAGTTTGCCCGGCTGTGGGCTGG - Intronic
1104773435 12:131378946-131378968 GGGTTGGGCCGGCTCCTGTCAGG + Intergenic
1126060905 15:44781610-44781632 GAGTTTGGCTAGCTATAGGCTGG + Intergenic
1127233894 15:57026263-57026285 GAGTTTGGCACACTATTGGCTGG - Intronic
1130221145 15:82020670-82020692 GGGTTTGGCTGGCTTTGGACAGG - Intergenic
1132368686 15:101277521-101277543 GGGGTCGGCCTGCGATTGGCCGG - Intergenic
1134056720 16:11174658-11174680 GGGGTTGGGCGGCAGTTGGCTGG + Intronic
1136116029 16:28095304-28095326 GGGTTGGGGCGGATAATGGCAGG - Intergenic
1137353064 16:47731426-47731448 GGGTTTGGCTGGCTGTTGAGAGG + Intergenic
1137400016 16:48145737-48145759 GAGGTGGGCCGGCTGTTGGCTGG - Intronic
1138469990 16:57226689-57226711 GGTTTTGGCCAGCTTCTGGCTGG + Intronic
1144217006 17:13065112-13065134 GGGTTTGGCAGGCTATTAATGGG + Intergenic
1144489723 17:15698430-15698452 GGTTCTTGCAGGCTATTGGCTGG + Intergenic
1144911241 17:18683529-18683551 GGTTCTTGCAGGCTATTGGCTGG - Intergenic
1147260661 17:39208240-39208262 GGGCTAGGCTGGCTACTGGCTGG + Intergenic
1147313156 17:39606757-39606779 GGGCTGGGCCGGCTCTGGGCGGG - Intronic
1147743254 17:42680458-42680480 GGGTCTGGCCGGCAATGGCCTGG - Exonic
1149546552 17:57508184-57508206 GCCTGTGGCCCGCTATTGGCTGG + Intronic
1152458084 17:80427475-80427497 GGATTTGGCAGGCTCTTTGCTGG - Intronic
1159867253 18:73720810-73720832 GAGATTGCCTGGCTATTGGCAGG - Intergenic
1163392358 19:17038393-17038415 GGGTTGGACAGGCCATTGGCCGG - Intergenic
1167142594 19:47662257-47662279 GGGCTTGGCTGGCTGTTAGCTGG + Intronic
1202712678 1_KI270714v1_random:26519-26541 GGGTTCGGCCTGGGATTGGCGGG - Intergenic
926410312 2:12595928-12595950 GGGTTTGGCAGACTAATGGATGG + Intergenic
936081755 2:109437106-109437128 GGGCTTGGCTGGCCGTTGGCTGG - Exonic
936145038 2:109975278-109975300 GGGTGTGTCCAGCTATGGGCTGG + Intergenic
936181724 2:110273240-110273262 GGGTGTGTCCAGCTATGGGCTGG + Intergenic
936199647 2:110396189-110396211 GGGTGTGTCCAGCTATGGGCTGG - Intergenic
936230841 2:110698439-110698461 GGGTGTGTCCAGCTATGGGCTGG - Intergenic
937810295 2:126192141-126192163 TGGTTTGGCCTGCTATGGACTGG - Intergenic
939884355 2:147665180-147665202 GGGCTTGGCTGGCTATAGGCTGG + Intergenic
940501119 2:154494798-154494820 GAGTTTGGCAGCCTATTGTCAGG + Intergenic
943163316 2:184283070-184283092 GGGGTTGGGGGGCTATTGGGAGG + Intergenic
948590700 2:239047811-239047833 GTGTTTGCCCGGCTGTGGGCAGG + Intergenic
1170647806 20:18212449-18212471 GGAGTTGGCTGGCTGTTGGCTGG + Intergenic
1170771617 20:19337847-19337869 GTGGTTGGCTGGCTTTTGGCTGG + Intronic
1172096319 20:32462258-32462280 TGGTTAGGCCGGCTAGAGGCAGG + Intronic
1182039994 22:27230550-27230572 GGGATTGGCTGGCTGTTGGCTGG + Intergenic
1182733220 22:32512005-32512027 GCTTTTGACGGGCTATTGGCTGG - Intergenic
1182831589 22:33308691-33308713 GGGTTTGTCTGGCTATCAGCAGG - Intronic
1184454203 22:44599791-44599813 GGGCTTGGCCTGCCCTTGGCTGG + Intergenic
950152081 3:10695618-10695640 GGGGTTGGCTGGCTCTAGGCTGG - Intronic
950657871 3:14448434-14448456 GGGTTTGGCCGGCTATTGGCTGG + Intronic
952527440 3:34225275-34225297 GAGTTTGGCTAGCTATAGGCTGG - Intergenic
953132186 3:40150727-40150749 GGAGTTGGCCGGCTATTGGCTGG + Intronic
954313165 3:49786111-49786133 AGGGTTGGCCGGCTAGTAGCGGG - Exonic
969906910 4:10405656-10405678 GGGTTTTGGCGGGTTTTGGCGGG + Intergenic
969906912 4:10405666-10405688 GGGTTTTGGCGGGTTTTGGCCGG + Intergenic
980850010 4:138369946-138369968 GGGACTGCCAGGCTATTGGCAGG + Intergenic
981694153 4:147542418-147542440 GTGTTTGGCCGGGAATGGGCTGG + Intronic
984170839 4:176357630-176357652 GGTTTTGGCCGGCTTTTTACTGG + Intergenic
984388262 4:179092850-179092872 GGGTTTGCCTGGCTATTGCCTGG + Intergenic
984950683 4:185005321-185005343 GGATTTGGCCGTTTCTTGGCGGG - Intergenic
997458833 5:134038461-134038483 GGGTTTTGCCGGCTCTGGCCAGG + Intergenic
998539732 5:142969351-142969373 TAGTTTGGCAGGCTCTTGGCAGG + Intronic
1002535406 5:179873047-179873069 GGGTTGGGGTGGCTATGGGCAGG - Intronic
1003426904 6:6003652-6003674 GGGTTTGGCCGTCCAGAGGCCGG - Intronic
1007077827 6:39079084-39079106 GGGTGGGGCCGGGGATTGGCAGG - Intronic
1012299745 6:97571118-97571140 GGTTTTGGGGTGCTATTGGCTGG + Intergenic
1023735785 7:43235019-43235041 GGGTCTGGCAGGGGATTGGCCGG - Intronic
1024550171 7:50556123-50556145 GGGTTTGGGCAGCTCTTGGCTGG + Intronic
1031439784 7:121779636-121779658 GGGTTTGGCCAGCCCTTGGGAGG - Intergenic
1034763584 7:153696422-153696444 GAGTTGGGCCGCCTAGTGGCTGG - Intergenic
1036736130 8:11318274-11318296 GTGGTTGGCCGGCCATGGGCAGG + Intronic
1038126519 8:24679534-24679556 GGTTTTGGCTGGCTTCTGGCTGG - Intergenic
1041121600 8:54591788-54591810 GGGGTTGGTTGGCTGTTGGCTGG + Intergenic
1045859277 8:106797149-106797171 GTTTTTTGCTGGCTATTGGCTGG - Intergenic
1049313005 8:141943302-141943324 CTGTGTGGCCGGCTTTTGGCAGG + Intergenic
1050296220 9:4208079-4208101 TGGTTAGGCCTGCTCTTGGCAGG - Intronic
1056683107 9:88737223-88737245 GGTCTTGGCTGGCTGTTGGCTGG + Intergenic
1057711257 9:97447466-97447488 GGTTTTGGCCTGCTTTAGGCTGG - Intronic
1061050219 9:128190995-128191017 GAGTGTGGCAGGCTCTTGGCAGG - Intronic
1062044810 9:134420075-134420097 GAGAGTGGCCGGCTAGTGGCTGG + Intronic
1187216443 X:17281722-17281744 GTGATTGGCAGGCTATTAGCTGG - Intergenic
1187415487 X:19089737-19089759 GGGGTTGGCCAGCTCTTGGTTGG - Intronic
1189265094 X:39709215-39709237 GTGGTTGCCAGGCTATTGGCTGG + Intergenic