ID: 950658214

View in Genome Browser
Species Human (GRCh38)
Location 3:14450463-14450485
Sequence TGAGTACCAAGCTGGCAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 164}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950658214 Original CRISPR TGAGTACCAAGCTGGCAGCC AGG (reversed) Intronic
900265732 1:1756105-1756127 TGAGGCCCATGGTGGCAGCCCGG - Intronic
900393121 1:2442453-2442475 TGGGCACCAAGCTGGGAGCCAGG - Intronic
901609881 1:10489514-10489536 TGAGTCCCAAGCAGCCAGACTGG - Intronic
902251418 1:15156111-15156133 TGAGGCCCAAACTGCCAGCCTGG + Intronic
902534988 1:17114370-17114392 TAAGTACCAGGAGGGCAGCCTGG + Intronic
902715606 1:18270511-18270533 TGAGCACCAAGCTGGCACCTGGG + Intronic
902811351 1:18889819-18889841 GGAGGACCAAGGTGGCAGCCTGG - Intronic
902821931 1:18948757-18948779 TGAGAACCAAGCTGGAAACTGGG - Intronic
903527551 1:24003562-24003584 TTACTACCAAGCTAGCAACCTGG - Intergenic
904773325 1:32893125-32893147 TAAGTACCGGGCTGGCACCCGGG - Intronic
905449574 1:38047616-38047638 TGAGTACCGCGCGGGCAGCTGGG + Intergenic
905562783 1:38940697-38940719 TGAATACCAAGCTGGGTGCCAGG - Intronic
905910032 1:41647372-41647394 TGTGTGCTAAGCAGGCAGCCAGG - Intronic
906153565 1:43601417-43601439 TGAGTGCCAAGCTCAGAGCCTGG - Intronic
906282686 1:44565256-44565278 TGGGTACCAATCTGGAAGCCTGG + Intronic
908247292 1:62237939-62237961 TGTGTAGCAAGCAGGCAGGCAGG - Exonic
909546932 1:76858441-76858463 TGAGTGCCACACTGGCTGCCAGG + Intergenic
912700474 1:111874766-111874788 TGAGTACACAGCTCTCAGCCTGG + Intronic
918229929 1:182518912-182518934 AGAGTACCAAAATGGCAGCATGG - Intronic
918273700 1:182929447-182929469 TGAGTACTAACCTTGTAGCCAGG - Intronic
922037907 1:221867281-221867303 TGGGGAACAAGCTGTCAGCCAGG - Intergenic
923379912 1:233406624-233406646 TGAGTACCAGGCTGGCTCCCAGG + Intergenic
1062828486 10:588758-588780 AGAGTACCAGCCTGGCAGGCTGG - Intronic
1063035521 10:2283226-2283248 AGAGAACCAGACTGGCAGCCTGG + Intergenic
1067689606 10:48493384-48493406 TGAGGACCAGGCTGGGAGACTGG - Intronic
1067941248 10:50659096-50659118 TCAGCCTCAAGCTGGCAGCCTGG - Intergenic
1068399013 10:56504465-56504487 TGAGTACCATGAGGGGAGCCAGG + Intergenic
1069359692 10:67627326-67627348 TGAGTACCCATGTGGCACCCAGG - Intronic
1070862471 10:79683968-79683990 TCAGCCTCAAGCTGGCAGCCTGG - Intergenic
1076303106 10:129442643-129442665 TGAGAGCCAAGTGGGCAGCCTGG - Intergenic
1077406581 11:2385100-2385122 TTAGCGCCAAGATGGCAGCCTGG + Intronic
1077631041 11:3811197-3811219 TGAGTGCCAGCCTGGCTGCCTGG + Intronic
1077638246 11:3857969-3857991 TAAGAACCAAGCTTTCAGCCAGG - Intronic
1080169460 11:29281852-29281874 TGAGTAACAAGCTGGCAGCAAGG - Intergenic
1080418845 11:32092669-32092691 AGAGGACCCAGCAGGCAGCCTGG + Intronic
1081630334 11:44685209-44685231 GGAGTACAAAGCTGGCCGCAAGG + Intergenic
1086305151 11:85472076-85472098 TGAAAACCAAGCTGCCAGTCTGG + Intronic
1087107361 11:94423698-94423720 TGAGTACCTTCCTGGCAGCCTGG + Intronic
1090447232 11:126774816-126774838 TGGCAACCAAGCTGACAGCCTGG + Intronic
1091011038 11:132000718-132000740 TGAGTACCATGCTGGTACCAGGG + Intronic
1091650474 12:2305380-2305402 GGAGCACCAGGCTGGGAGCCAGG - Intronic
1091724294 12:2834810-2834832 TGAGCACCAAGCAGGAGGCCAGG - Exonic
1095357392 12:41291924-41291946 TGAGTACCAAACTGGGAGGAAGG + Intronic
1096669355 12:53189336-53189358 TGAGTGCCAAGCTGTCAGTAGGG + Exonic
1097120793 12:56730182-56730204 TGAGAAGCAAGCTGTCAGGCTGG - Intronic
1098991006 12:77065260-77065282 GGAGTGGCAGGCTGGCAGCCGGG + Intronic
1099697845 12:86044195-86044217 TGAGAACAAAGCTGGGAGCCTGG - Intronic
1102963703 12:117110876-117110898 TGAGAACCAGTGTGGCAGCCTGG - Intergenic
1103613711 12:122139267-122139289 CGAGGACCGAGCTGGCTGCCAGG - Intronic
1106610033 13:31270030-31270052 TTGGTCCCAAGCAGGCAGCCTGG + Intronic
1108442233 13:50466651-50466673 TCAGGACCAAGCTCCCAGCCAGG - Intronic
1109399307 13:61805097-61805119 TAAGGACCAAGCTGCCAGGCTGG - Intergenic
1111258226 13:85700353-85700375 TGAATTCCAGCCTGGCAGCCTGG - Intergenic
1112075343 13:95907176-95907198 TGAACTGCAAGCTGGCAGCCTGG + Intronic
1112950130 13:104984376-104984398 TCAGTAGCTGGCTGGCAGCCAGG + Intergenic
1113414540 13:110117987-110118009 TGGGGACCAAGGAGGCAGCCAGG - Intergenic
1114784262 14:25576779-25576801 TGAATACCAAGCTGGCAAGCAGG - Intergenic
1116750248 14:48873886-48873908 TGAACATCAAGCTGGCAGACAGG + Intergenic
1117447131 14:55814875-55814897 TGTGTACCCACCTGGCAGTCAGG - Intergenic
1118155218 14:63233767-63233789 TGAGTCCCAAGCGAGAAGCCAGG - Intronic
1118809424 14:69262077-69262099 TGAGTATGAATGTGGCAGCCTGG - Intronic
1121613617 14:95298149-95298171 TGGGTGCCATGGTGGCAGCCGGG - Intronic
1121680313 14:95788062-95788084 TGAATGCCAGGCTGGCAGCTTGG - Intergenic
1122863144 14:104591522-104591544 TGAGTTTCCAGCTGGCAGCCAGG - Intronic
1128043617 15:64597244-64597266 TGAGTGCTTAGCTGGCAGACGGG + Intronic
1130300401 15:82676189-82676211 AGAGTTCCAAGGTGGCAGACAGG + Intronic
1132114648 15:99126476-99126498 TGAGCGCCATGCTGGCTGCCAGG + Intronic
1132515589 16:364299-364321 TGAGAACTGAGCTGGGAGCCCGG - Intergenic
1132539538 16:502053-502075 TGAGCATCAGGCTGTCAGCCTGG + Intronic
1132991527 16:2798211-2798233 GGGGCACCAAGCGGGCAGCCAGG + Intergenic
1133326725 16:4946435-4946457 TGAGTACCAGGCTTGGAGGCTGG + Intronic
1136408856 16:30065113-30065135 CGAGTTCCAGGCTGGCAGGCCGG - Intronic
1138325881 16:56167125-56167147 TGAGTAACAAACTGGAACCCTGG - Intergenic
1139903057 16:70343197-70343219 TGAATTCCTAGCTGGCAGCAGGG + Intronic
1140468058 16:75197871-75197893 TGACTACCAGGCTGGCAGTGAGG - Intergenic
1146497631 17:33337119-33337141 TCAGAACCAAGCAGGCACCCTGG - Intronic
1147477869 17:40730521-40730543 TAAGTACTGAGCTGGGAGCCAGG + Intergenic
1149123392 17:53197495-53197517 TGAGTACTATGCTTACAGCCTGG - Intergenic
1149246084 17:54709970-54709992 TGTGTACCAAGCTGTAAGCTGGG + Intergenic
1153818228 18:8809500-8809522 CGTGGACCCAGCTGGCAGCCTGG - Intronic
1153966114 18:10183589-10183611 TGAGTACCCATGTGGCACCCAGG + Intergenic
1154472032 18:14712882-14712904 TGAGTAGCCAGAGGGCAGCCAGG - Intergenic
1157301497 18:46482969-46482991 TGGTAACCAAGCTGGAAGCCAGG - Intronic
1157535681 18:48455731-48455753 TGAGGTCAATGCTGGCAGCCTGG - Intergenic
1158877287 18:61745399-61745421 TGAGTTCCAAGCTGGAATCTGGG + Intergenic
1161516665 19:4700221-4700243 TGAGTTCCAGACTGACAGCCAGG - Exonic
1162300620 19:9842859-9842881 TCACTCCCCAGCTGGCAGCCGGG + Intronic
1162683839 19:12365575-12365597 TGAGTCCTATGCTGGCAGCGGGG - Exonic
1163406960 19:17128777-17128799 GGAGGTCCAAGCTGGCTGCCAGG + Intronic
1163574664 19:18103661-18103683 TGAGTAGCAAGCTCAGAGCCTGG - Intronic
1165346303 19:35250507-35250529 TCAATGCCCAGCTGGCAGCCGGG + Exonic
1165570821 19:36773212-36773234 TGAGTTCCAAACTAACAGCCAGG - Exonic
925827864 2:7867742-7867764 TGAGTACCATGCTGAATGCCAGG - Intergenic
931025341 2:58107909-58107931 TGAGTAGCAAGCAGCCAGACTGG - Intronic
931460021 2:62442534-62442556 TGACCACCAAACTGGCAGCTTGG + Intergenic
931460023 2:62442540-62442562 TGAGGACCAAGCTGCCAGTTTGG - Intergenic
932409790 2:71538875-71538897 AGAGATCCAGGCTGGCAGCCTGG + Intronic
932424360 2:71619754-71619776 TGAGTACCAGGCTAGCAGGTGGG - Intronic
934951715 2:98580263-98580285 TGGGGGCCAAGCTGGCACCCAGG + Intronic
936465406 2:112744339-112744361 TGAATCCCAAGCTGGCAGTGTGG + Intronic
938552209 2:132392821-132392843 GGAGTGCTAAGCTGGCACCCTGG + Intergenic
938899390 2:135786963-135786985 TGAGTCCCAACCTGGCAGTCAGG - Intergenic
1169288533 20:4329563-4329585 TCAAGATCAAGCTGGCAGCCTGG + Intergenic
1170399889 20:15970531-15970553 TGATTGCCCAGCTGGCTGCCTGG + Intronic
1172271661 20:33658698-33658720 TGAGTCCCCAGCTGGCAGGTGGG - Intronic
1172476427 20:35241689-35241711 TCAGTAAAAAGCTGGCAACCTGG - Intronic
1174334515 20:49849432-49849454 TGTGTGGCAAGCTGGGAGCCCGG - Intronic
1176802461 21:13445020-13445042 TGAGTAGCCAGAGGGCAGCCAGG + Intergenic
1177709027 21:24746839-24746861 TGAGTACCAAGCAAGAAGGCCGG + Intergenic
1179236809 21:39554720-39554742 TGAGTACAATGCTGGCAGTAAGG - Intergenic
1179329087 21:40381143-40381165 TGAGGACCAAGGTGGCTGCTAGG + Intronic
1181099301 22:20528668-20528690 TGAGCAGCATGCTGGCAGCCAGG - Intronic
1181887511 22:26033044-26033066 TGTGGACCAAGCTGGGAGCTTGG - Intergenic
1182103418 22:27672628-27672650 TGAGCACCATTCTGACAGCCAGG + Intergenic
1182473371 22:30561995-30562017 AGAGGAGCTAGCTGGCAGCCAGG + Intronic
1184658110 22:45952323-45952345 TGAGTGTCACCCTGGCAGCCCGG - Intronic
950583357 3:13877471-13877493 TGAGCACCTAGCTGGCCACCAGG + Intronic
950658214 3:14450463-14450485 TGAGTACCAAGCTGGCAGCCAGG - Intronic
951047954 3:18062453-18062475 TCAGCACCATTCTGGCAGCCTGG - Intronic
954373580 3:50183020-50183042 TGAGTGCCCAGCAGGCAGGCAGG + Intronic
954413085 3:50379701-50379723 TGAGTGCCAAGGTGGCAGACGGG - Intronic
954452357 3:50578651-50578673 AGGGTCCCCAGCTGGCAGCCTGG - Intronic
954656423 3:52197055-52197077 TGAGCACCCAGCTGGCTGCAAGG - Intergenic
958539117 3:95447354-95447376 TAATTACCAACCTGGCAGCCAGG + Intergenic
958739145 3:98047222-98047244 TGAGTACCAATTTGTCAGCCTGG + Intergenic
966287838 3:178318651-178318673 TGAGTAGCTAGCTGTCAGACTGG + Intergenic
968465885 4:750650-750672 TGAGAAACAAGCAGGCAGCCTGG + Intronic
969353163 4:6609897-6609919 GGAGTACCAAGCCGGCCCCCTGG + Exonic
972346322 4:38195499-38195521 TGAGTACCAAGCTCAGTGCCAGG - Intergenic
973259929 4:48152692-48152714 TGAGTAGCTAAATGGCAGCCTGG - Intronic
978018004 4:103772307-103772329 TAAGTAGCAAGTTGGAAGCCAGG + Intergenic
978748469 4:112221769-112221791 TGAGCTCTCAGCTGGCAGCCAGG - Intergenic
980827475 4:138089864-138089886 TTAGCAGCAAGCAGGCAGCCAGG - Intergenic
985899395 5:2776879-2776901 TCAGTTACAAGCTGGCTGCCTGG + Intergenic
988994861 5:36705181-36705203 TGAGCAGCAACCTGGGAGCCAGG + Intergenic
996641816 5:125763277-125763299 TGAGTACTATGCTGGCACCTGGG + Intergenic
997387349 5:133483819-133483841 TGAGAGCCAAGGAGGCAGCCTGG - Intronic
999213752 5:149914150-149914172 TGAGTCCCAATCTCACAGCCAGG - Intronic
999826224 5:155276065-155276087 TGAGCACCAAGCTGGTACACTGG + Intergenic
1001720020 5:173849263-173849285 TGAGTTCCTACCTGACAGCCAGG - Intergenic
1002101050 5:176857836-176857858 TTAATTCCAAGCGGGCAGCCAGG + Intronic
1007358338 6:41336612-41336634 TGACTCCCAAGCCTGCAGCCTGG + Intronic
1010232793 6:73550311-73550333 TGAATACCCTGGTGGCAGCCTGG - Intergenic
1011336968 6:86272246-86272268 TGATTTGCAAGATGGCAGCCTGG - Intergenic
1013023628 6:106246260-106246282 AGAGTCCCCATCTGGCAGCCAGG + Intronic
1019501584 7:1367380-1367402 TGAGGCCCGAGCTGGCATCCTGG - Intergenic
1021353803 7:19628690-19628712 TGAGTTCCCATCTGGGAGCCAGG - Intergenic
1022178643 7:27896950-27896972 TGAGTACCTACCTGGCTACCAGG - Intronic
1026101804 7:67390068-67390090 TGAGGACCAAGCTGGCATCAGGG - Intergenic
1029298372 7:99559103-99559125 TGAGGACCGAGCTGGGAGCCGGG + Intronic
1029312460 7:99679833-99679855 GGAGCACCAGGCTGACAGCCAGG + Exonic
1029318346 7:99735030-99735052 GGAGTATCAGGCTGACAGCCAGG + Exonic
1029323263 7:99784018-99784040 GGAGCACCAGGCTGACAGCCAGG + Exonic
1029327185 7:99820059-99820081 GGAGCACCAGGCTGGTAGCCAGG - Intergenic
1030934590 7:115569670-115569692 GAAGTAGCAAACTGGCAGCCAGG - Intergenic
1031069261 7:117143699-117143721 TGAGTACTAAACTAGCACCCTGG - Intronic
1031174763 7:118336471-118336493 TGAGTACCAGACTTGGAGCCAGG - Intergenic
1033285009 7:140033735-140033757 TCAGTCCCAAGATGGCTGCCAGG - Intronic
1033657436 7:143382853-143382875 CCAGTACCAAGCCTGCAGCCGGG + Exonic
1034267112 7:149786382-149786404 TGAGAGCTAAGCTGACAGCCAGG + Intergenic
1034910115 7:154989468-154989490 TGAGCACCAAAATGACAGCCTGG + Intronic
1035191955 7:157177690-157177712 TGAGGACCCAGCGGGCAGGCTGG - Intronic
1035535258 8:386166-386188 TGAGGACCATGGAGGCAGCCTGG - Intergenic
1035840893 8:2811053-2811075 TGAGTACAAAGAGGGCAGCAGGG + Intergenic
1038905288 8:31895365-31895387 TGAGTACCTGGCTTTCAGCCAGG + Intronic
1044809061 8:96038841-96038863 TGAGTTGCAAGGTGGAAGCCTGG - Intergenic
1046250220 8:111621643-111621665 TGAGTACCATGCAGCCATCCTGG - Intergenic
1049085268 8:140473688-140473710 TGGGTACCCAGCTGGGACCCAGG - Intergenic
1049284441 8:141767029-141767051 TCAGTGCCACCCTGGCAGCCTGG + Intergenic
1051903133 9:22064272-22064294 TGAGTACCAAGGTGGAAGTGTGG + Intergenic
1052685013 9:31744594-31744616 TGGGTATAAAGCTGGGAGCCTGG - Intergenic
1056785868 9:89592148-89592170 TGAATTCCAAGTGGGCAGCCTGG - Intergenic
1058814236 9:108668769-108668791 TGGGTCCTATGCTGGCAGCCTGG - Intergenic
1059460950 9:114429662-114429684 TGAGTACCAAGCCCCGAGCCAGG - Intronic
1060177969 9:121511422-121511444 TAAGAACCAGGCTTGCAGCCAGG + Intergenic
1062115309 9:134805374-134805396 CGCATCCCAAGCTGGCAGCCAGG + Intronic
1062157719 9:135062759-135062781 TGAGTACCAGGCAGGCTACCAGG + Intergenic
1062454329 9:136628632-136628654 TGAGGCCCAAGCTGGCTGCCGGG + Intergenic
1186276135 X:7940031-7940053 TGTGTACGAAGCAGGCAGCTGGG + Intergenic
1186555177 X:10550510-10550532 TGAGTGGCAGCCTGGCAGCCTGG - Intronic
1190708251 X:53048403-53048425 GGAGGACCAGGCTGGCAGCTGGG + Intergenic
1192592127 X:72369048-72369070 TGAGAACCAAACTGAGAGCCTGG - Intronic
1192759948 X:74086413-74086435 TGAGTATCCTTCTGGCAGCCGGG + Intergenic
1193416684 X:81233644-81233666 TGGGTGCCAAGCTTGGAGCCAGG + Intronic
1194049803 X:89054509-89054531 TCAGCACCAACCTGCCAGCCAGG - Intergenic
1197748047 X:129946189-129946211 TCACTACCAAGCAGGCAGCCAGG - Intergenic