ID: 950658493

View in Genome Browser
Species Human (GRCh38)
Location 3:14452134-14452156
Sequence CTGTGAAAACAGAGGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 704
Summary {0: 1, 1: 0, 2: 8, 3: 65, 4: 630}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950658493_950658505 27 Left 950658493 3:14452134-14452156 CCTTCCTCCCTCTGTTTTCACAG 0: 1
1: 0
2: 8
3: 65
4: 630
Right 950658505 3:14452184-14452206 CATTCCCCTTTCCTTGTGGGGGG 0: 1
1: 0
2: 1
3: 20
4: 219
950658493_950658500 1 Left 950658493 3:14452134-14452156 CCTTCCTCCCTCTGTTTTCACAG 0: 1
1: 0
2: 8
3: 65
4: 630
Right 950658500 3:14452158-14452180 GGAGGCAGCAGAGCAGCAATGGG 0: 1
1: 0
2: 2
3: 40
4: 415
950658493_950658501 23 Left 950658493 3:14452134-14452156 CCTTCCTCCCTCTGTTTTCACAG 0: 1
1: 0
2: 8
3: 65
4: 630
Right 950658501 3:14452180-14452202 GTGACATTCCCCTTTCCTTGTGG 0: 1
1: 0
2: 0
3: 20
4: 192
950658493_950658502 24 Left 950658493 3:14452134-14452156 CCTTCCTCCCTCTGTTTTCACAG 0: 1
1: 0
2: 8
3: 65
4: 630
Right 950658502 3:14452181-14452203 TGACATTCCCCTTTCCTTGTGGG 0: 1
1: 0
2: 0
3: 14
4: 239
950658493_950658503 25 Left 950658493 3:14452134-14452156 CCTTCCTCCCTCTGTTTTCACAG 0: 1
1: 0
2: 8
3: 65
4: 630
Right 950658503 3:14452182-14452204 GACATTCCCCTTTCCTTGTGGGG 0: 1
1: 0
2: 0
3: 16
4: 169
950658493_950658499 0 Left 950658493 3:14452134-14452156 CCTTCCTCCCTCTGTTTTCACAG 0: 1
1: 0
2: 8
3: 65
4: 630
Right 950658499 3:14452157-14452179 AGGAGGCAGCAGAGCAGCAATGG 0: 1
1: 1
2: 7
3: 107
4: 728
950658493_950658504 26 Left 950658493 3:14452134-14452156 CCTTCCTCCCTCTGTTTTCACAG 0: 1
1: 0
2: 8
3: 65
4: 630
Right 950658504 3:14452183-14452205 ACATTCCCCTTTCCTTGTGGGGG 0: 1
1: 0
2: 0
3: 32
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950658493 Original CRISPR CTGTGAAAACAGAGGGAGGA AGG (reversed) Intronic
900084076 1:878840-878862 CTCTGGAATCAGATGGAGGAAGG - Intergenic
900101546 1:964228-964250 GTGGGTAAACAGAGGGAGGAGGG - Intronic
901234729 1:7661703-7661725 CTGTGAAGAGAGAGGCAGGGGGG - Intronic
901246259 1:7733850-7733872 ATATGAAAACACGGGGAGGAAGG - Intronic
902724491 1:18325746-18325768 CTGGGAAAACAGATGGAGACAGG - Intronic
902777675 1:18685004-18685026 CTCTGGCAAAAGAGGGAGGAGGG + Intronic
904392518 1:30195372-30195394 ATGTGAGAAGAGAAGGAGGAAGG - Intergenic
904804041 1:33118503-33118525 CTGTGACTGCAGAGGGAGGCAGG + Intronic
905054819 1:35084226-35084248 TTGAGAAAACAGAGGAAAGATGG - Intronic
905313580 1:37066894-37066916 ATGTCAAAACAAAGGGAGGAAGG - Intergenic
905361074 1:37420836-37420858 CTGTGGATACTGAGGGATGATGG - Intergenic
905716502 1:40155877-40155899 CTGAAAAAACAGGGGGAGGGAGG - Intergenic
906232250 1:44173753-44173775 AAGAGAAAATAGAGGGAGGAAGG + Intergenic
906315839 1:44786022-44786044 CTTTAAAATTAGAGGGAGGAGGG + Intronic
906674587 1:47684034-47684056 GTGTGCAAACAGTGGGTGGATGG + Intergenic
906700110 1:47851464-47851486 GTGAGGAAAAAGAGGGAGGAAGG + Intronic
907123675 1:52030619-52030641 CTGTTAAAAGAGAGGGTAGATGG - Intronic
907394291 1:54178531-54178553 ATGTGGAGTCAGAGGGAGGAGGG + Intronic
907575020 1:55518635-55518657 AGGTGAAATCAGAGGGAGGAAGG + Intergenic
908294305 1:62698016-62698038 CTCTTGAAACAGAGGGAGCAGGG + Intergenic
908389090 1:63669349-63669371 CTGTGGGAATAGAGGGATGAAGG + Intergenic
908529958 1:65025018-65025040 CAGTGAAAACAGAGCTAAGAGGG - Intergenic
908568311 1:65381668-65381690 CTGTGAAAAGAGTGTCAGGAAGG + Intronic
908859143 1:68463724-68463746 CTGATTTAACAGAGGGAGGAGGG - Intergenic
909469299 1:76008822-76008844 GTGGGAAGAGAGAGGGAGGAAGG - Intergenic
910628892 1:89337074-89337096 CTGTGGATTCAGAGGGTGGAAGG + Intergenic
911083818 1:93959568-93959590 CTACGCAACCAGAGGGAGGAGGG - Intergenic
912628598 1:111227361-111227383 GTGTGAACACAGAGAGAGGTGGG + Intronic
913229667 1:116731325-116731347 CTGTGAAGGCTGAGGGAGAAAGG - Intergenic
913369728 1:118084558-118084580 CTTTGAAGACAGTGGGAAGAGGG - Intronic
915346707 1:155201249-155201271 CAGGGAAAATATAGGGAGGAGGG - Intronic
915405932 1:155659783-155659805 TTGTGAAAACAGAGGAGGGAAGG - Exonic
915419097 1:155765576-155765598 TTGTGAAAACAGAGGAGGGGAGG - Exonic
915724307 1:158006972-158006994 CAGTGTAAGCAGAGAGAGGAGGG + Intronic
916392140 1:164342412-164342434 CTGGCAAAGCAGTGGGAGGAGGG - Intergenic
916444617 1:164860845-164860867 CTCAGACAAGAGAGGGAGGAAGG + Intronic
916841950 1:168609862-168609884 CTGAGGAGACAGAGGGGGGAGGG + Intergenic
917416209 1:174812729-174812751 CTGTGAAAAAAAAGAGAGTAGGG + Intronic
918237881 1:182597957-182597979 CTGTGAGCACTGAGGGAGGGAGG - Intergenic
918269127 1:182879202-182879224 CTGTGTATACACAAGGAGGATGG + Intronic
918385657 1:184005037-184005059 CCCTGAAAACAGAGGCATGATGG + Intronic
918484998 1:185019346-185019368 CTGTGAAGGCACAGGGAGTAAGG - Intergenic
919246721 1:194996910-194996932 CCCTGAAAACAGAGAGAGAATGG + Intergenic
919246801 1:194998219-194998241 CCCTGAAAACAGAGAGAGAATGG + Intergenic
920004768 1:202825063-202825085 GTGGGAAATAAGAGGGAGGAAGG + Intronic
920349298 1:205327350-205327372 CTGTGTTAAGGGAGGGAGGAAGG + Intergenic
920516102 1:206585550-206585572 TTCTGAAAACTCAGGGAGGAGGG + Intronic
920742889 1:208598150-208598172 CTGGGAAAAGAGATGGAGGAGGG + Intergenic
920957101 1:210629712-210629734 CTTTGAAAACAGAGGAAGGAAGG - Intronic
921884153 1:220287639-220287661 CAGTGAAAAGTGAAGGAGGATGG - Intergenic
922182910 1:223249866-223249888 CAGTGAAAAGAGAGGAAGAAAGG + Intronic
922424523 1:225480835-225480857 CTGAGAGAAAAGAGTGAGGAGGG - Intergenic
922580672 1:226695600-226695622 GTGTGAGAAGAGAGAGAGGATGG - Intronic
922671635 1:227512512-227512534 CTCTGGAACCAGATGGAGGAAGG - Intergenic
923548236 1:234940456-234940478 CTGAGAAAGCATGGGGAGGAGGG - Intergenic
924154363 1:241160916-241160938 GTGTGAAATCAGAAGGAGTATGG + Intronic
924157934 1:241200610-241200632 CTGTGAAACAAGAGGTTGGAGGG - Intronic
924244075 1:242064459-242064481 CTCTGGAACCAGATGGAGGAAGG - Intergenic
1062763170 10:43096-43118 CTCTGGAATCAGATGGAGGAAGG + Intergenic
1062931731 10:1357340-1357362 CTGAGAAAAATGAGGGAGGTTGG + Intronic
1062940925 10:1420969-1420991 CTGTGAGAGCAGAGAGAGGAAGG - Intronic
1063195688 10:3740629-3740651 CTGAGAAAACAGAGGTATTAAGG - Intergenic
1063450606 10:6147711-6147733 CCATGAGATCAGAGGGAGGAAGG - Intronic
1063736853 10:8766782-8766804 AAGTGAAGACGGAGGGAGGAAGG - Intergenic
1063865457 10:10360447-10360469 ATGTGAAAAAAGAGGAAGGAAGG + Intergenic
1064074098 10:12255163-12255185 AGGAGAAAACAGAGGGAGGGTGG - Intergenic
1064448851 10:15423356-15423378 CTGTAAAAACAGTGGGAGGGAGG + Intergenic
1064642133 10:17425932-17425954 CTGTGGAAAAAGAGTGGGGATGG - Intronic
1064706332 10:18076172-18076194 CTGTGAACTCAGAGGGGAGACGG - Intergenic
1064974196 10:21096619-21096641 CTGGGAAAACTGAGGCAGGAGGG - Intronic
1065037267 10:21652555-21652577 ATATGAAAACAGAGGGAGACTGG + Intronic
1065684916 10:28274627-28274649 CTGTGTAAACACTGGGTGGATGG - Intronic
1065695301 10:28374272-28374294 CTGGGCAAAGAGAGGGTGGATGG - Intergenic
1065708733 10:28495208-28495230 CTGGGAAGACAGAGGGAAGGAGG + Intergenic
1065813096 10:29460430-29460452 TAGTGAATACACAGGGAGGATGG + Intronic
1065972346 10:30815619-30815641 CTGTGAAAGCAGAGGCTCGAGGG - Intergenic
1066693773 10:38060273-38060295 CTGTGGAAGCAGAGTGGGGATGG - Intronic
1066999044 10:42588869-42588891 CTGTGGAAGCAGAGTGGGGATGG + Intronic
1067337934 10:45379432-45379454 CTGTGAGGACAGAGGGAGAGTGG - Intronic
1067856601 10:49799057-49799079 CAGTGACAGAAGAGGGAGGAGGG - Intergenic
1068606064 10:59006270-59006292 CTGTGAAGCTGGAGGGAGGAAGG + Intergenic
1070325957 10:75389302-75389324 CTGGGAAACTAGAGGGAGTAAGG - Intergenic
1070635683 10:78125376-78125398 CAGTAGAAACAGAGTGAGGAAGG + Intergenic
1070714281 10:78707927-78707949 GTGTGCATACAGAAGGAGGAAGG - Intergenic
1071407168 10:85348338-85348360 CTGAGAAAACAGATGCAAGAAGG + Intergenic
1071715571 10:88091976-88091998 CTGTGCAGACACAGGGAAGAAGG - Intergenic
1071730169 10:88240084-88240106 CTTTGAAAACAGAGCGAAGAAGG - Intergenic
1074707878 10:116151597-116151619 ATGGGAAAATAGAGGGAAGAGGG + Intronic
1075219963 10:120576336-120576358 CTGCAAAGACAGAGAGAGGAAGG - Intronic
1075542451 10:123326399-123326421 ATATGAAAGCAGAGGCAGGAAGG - Intergenic
1076021436 10:127076944-127076966 CTTTGAGAACAGAGGCAGGGAGG + Intronic
1076141289 10:128080398-128080420 CTGTGCATAGAGAGGCAGGAAGG + Intronic
1076259745 10:129055886-129055908 CAGTGAACACAGCGGCAGGAGGG + Intergenic
1076533393 10:131160343-131160365 CTGGGAGCACAGAGGAAGGATGG - Intronic
1077031237 11:468896-468918 CTGGGTAATCGGAGGGAGGAGGG + Intronic
1077474645 11:2780555-2780577 CTGAGAAAACAGTTGGAGGCTGG - Intronic
1077890295 11:6413436-6413458 CTGAGAACACAGAGGGAAGGGGG - Intronic
1078110828 11:8390435-8390457 CTGTGAAAGCAAATGGAGGAAGG + Intergenic
1078224910 11:9383267-9383289 CTCTAAAAAAAGAGGGAGGTGGG - Intergenic
1079729765 11:23925370-23925392 CTTTGAGAACAGAGGGAGTTTGG - Intergenic
1080698564 11:34624346-34624368 ATCTGAAGACAGAGGCAGGAGGG + Intronic
1081728972 11:45355264-45355286 CTGAGAAAGGAGAGGGAGGGGGG + Intergenic
1081751422 11:45513867-45513889 AAGTGAAGGCAGAGGGAGGAAGG + Intergenic
1082686663 11:56246219-56246241 CTGTGAAAACTGAGAGGGTAGGG - Intergenic
1083002563 11:59308501-59308523 TTCTGAATACAGAGGGAGGTGGG + Intergenic
1083275068 11:61592253-61592275 CTGTGAAAACTTAGGGAGATGGG + Intergenic
1083691748 11:64413498-64413520 CTGAGCAACCAGAGGAAGGATGG + Intergenic
1084101870 11:66955205-66955227 CTGAGAGGACAGAGGGAAGAGGG + Intronic
1084368608 11:68721269-68721291 CTGTGGCAAGAGAGGGAGGGTGG - Intronic
1084415366 11:69029264-69029286 TTTAGGAAACAGAGGGAGGAGGG - Intergenic
1084884075 11:72192025-72192047 CTGGGAAAACTGAGGGAGATGGG + Intronic
1085261285 11:75206167-75206189 CTGGGAAACAAGAGGGATGAAGG - Exonic
1085319820 11:75567077-75567099 CTGTGACAACCCAGGGAGGCAGG + Intronic
1085745317 11:79110118-79110140 CTGGCAACAGAGAGGGAGGAGGG - Intronic
1085782536 11:79422737-79422759 CTGGTAGAACAGAGGGAGGGAGG + Intronic
1086128743 11:83378663-83378685 GTGTGAAGACACAGGGAGAAAGG - Intergenic
1087013108 11:93531805-93531827 CTTTGAAAAGAAAGGGAGGCAGG - Intronic
1087676690 11:101170872-101170894 CTGTGATGGCAGAGAGAGGAAGG + Intergenic
1087693463 11:101348593-101348615 CTGAGAAAGTTGAGGGAGGAAGG + Intergenic
1087761762 11:102110469-102110491 CAGGGAAAAGAAAGGGAGGAAGG + Exonic
1089093198 11:115895834-115895856 CTGTGCAAACAAAGGCAGTAAGG - Intergenic
1089350753 11:117820373-117820395 CTGAGAAGACAAAGGCAGGATGG + Intronic
1089445216 11:118546483-118546505 CTGTAAAAAAAAAGGAAGGAAGG + Intronic
1089497223 11:118913896-118913918 CTGTGAAACCAGAGCTAGGTTGG - Intronic
1090319883 11:125833065-125833087 CAGGGAAGGCAGAGGGAGGATGG + Intergenic
1091099527 11:132858012-132858034 ATGTGAACACAGAGAGAGGGAGG + Intronic
1091663719 12:2403397-2403419 CTGTGAGGACCCAGGGAGGAGGG + Intronic
1091696316 12:2630500-2630522 CTGTTGAAATAGTGGGAGGAGGG + Intronic
1091760865 12:3086387-3086409 GAGAGAAAACAGAGGGCGGAAGG - Intronic
1091767894 12:3133786-3133808 CTGTGAAAATGGATGGATGACGG + Intronic
1092035967 12:5334754-5334776 TTGAGAAGACAGAGGGAGGGGGG + Intergenic
1092059484 12:5536802-5536824 ATGTGAGAACAGAGGGAAAATGG + Intronic
1092250407 12:6891914-6891936 CTGTGAATACTCTGGGAGGATGG + Intronic
1092265628 12:6978285-6978307 CTGGGAAGACAGTGGAAGGAAGG + Intronic
1092377542 12:7968307-7968329 CTCTGAAGGCAGAGGCAGGAAGG + Intergenic
1092582081 12:9852753-9852775 CTGTCAAAACAAAGGGGGGTGGG - Intergenic
1092629267 12:10361072-10361094 TTGTAGAGACAGAGGGAGGAGGG + Intergenic
1092927319 12:13283078-13283100 CTGTGAAGACTGAGGCAGCAGGG + Intergenic
1093046458 12:14451517-14451539 CAGTGAAAACAGTGGTAAGAAGG - Intronic
1093229537 12:16526762-16526784 CTGTGAAAAGTGAGCCAGGAAGG + Intronic
1093558455 12:20507888-20507910 TTGTGAATACACAGTGAGGAAGG - Intronic
1093993364 12:25614884-25614906 GTGTGAAAACAGGGAGAAGATGG - Intronic
1094813058 12:34160867-34160889 CTCTGAAATCAGATGGAGGAAGG + Intergenic
1097370144 12:58768493-58768515 CTAAGAAAACTGAGTGAGGAAGG + Intronic
1097777120 12:63660441-63660463 CTCTGAAAACAGAGATTGGATGG + Intronic
1098809446 12:75067782-75067804 TTATGAAAACAGAAGGAGGCAGG - Intronic
1099220746 12:79911186-79911208 CTGAAAAAAGAGTGGGAGGATGG - Intronic
1099844828 12:88016834-88016856 CTGAGAAATCATAGGGAGTATGG + Intronic
1100122825 12:91388613-91388635 CTGTACAAACACAAGGAGGAAGG + Intergenic
1101047985 12:100830565-100830587 CTGTAAGAACAGAGGGCTGATGG - Intronic
1101320517 12:103669300-103669322 CTGTGCGAACAGACAGAGGAAGG - Intronic
1101923944 12:108955884-108955906 ATGAGAAAACAGATGCAGGAAGG + Intronic
1102159940 12:110760415-110760437 CTGTGAAGACAGGTGGAAGACGG + Intergenic
1102216511 12:111165272-111165294 CTGAGAAAAGAGAAGTAGGAAGG + Intronic
1103024550 12:117562996-117563018 CTCTGGAGACAGAGGGAAGAGGG + Intronic
1103081402 12:118026866-118026888 CTGTGTAGACAGAGGGGGAAAGG - Intronic
1103533266 12:121617332-121617354 CTGTGAAAAAAAAAGAAGGAAGG + Intergenic
1103768382 12:123299886-123299908 CTGTGAAAAGAAAAGAAGGAGGG + Intronic
1104073761 12:125371367-125371389 CTGGGAAGAGACAGGGAGGAAGG + Intronic
1104239198 12:126971098-126971120 GTGTGAAAACAGAGGGGCAATGG + Intergenic
1104291233 12:127470861-127470883 CTTTTAAAACAAAGGGAGGGGGG - Intergenic
1104332136 12:127856818-127856840 CTGGGAAAACACAAGGAGGGAGG + Intergenic
1104427993 12:128693806-128693828 CTGCAAAGACAGAGGGAGAAAGG - Intronic
1104791760 12:131487201-131487223 ATCTGAATACAGGGGGAGGAGGG - Intergenic
1104833973 12:131775096-131775118 GTGTTAAAACAGAGGGGAGATGG - Intronic
1105444363 13:20439903-20439925 CTGAGAAAACAGCGGAAGCAGGG + Intronic
1105617770 13:22035567-22035589 CTGGGAAATCAGAGTGAAGAAGG - Intergenic
1105932736 13:25067894-25067916 CTGTGAAAAGAGAAAGAGGTAGG + Intergenic
1106925083 13:34605437-34605459 TTGAGAAAACAGAAGCAGGAAGG + Intergenic
1106954202 13:34917651-34917673 CTGTGAAAACAAAGGGCTGCAGG - Intergenic
1107223705 13:38019774-38019796 TTTTGAAAACATATGGAGGATGG - Intergenic
1107704966 13:43093187-43093209 TTAAGAAAACAGAGGGAAGATGG - Intronic
1107750638 13:43561962-43561984 CTGTCAAAAAAAAGGAAGGAAGG + Intronic
1108264580 13:48693648-48693670 CTCTGAAAAGAGAGGGAGGAAGG + Intronic
1108285406 13:48902440-48902462 CTTTGAAAAAAGGGGGATGATGG + Intergenic
1110332515 13:74288838-74288860 CTGACAGAACAGAGGCAGGAAGG - Intergenic
1110709055 13:78629846-78629868 CTATAAAAATAGAGGGATGATGG + Intronic
1111598521 13:90441991-90442013 GTGTGAAAGGAGAAGGAGGAGGG - Intergenic
1111683022 13:91467295-91467317 CTGTCACCACAGAGGGAGAAAGG + Intronic
1111764234 13:92507209-92507231 CTGTGAAGACAAACGGTGGATGG - Intronic
1112402795 13:99090014-99090036 ATGTGACAACAAAGGTAGGAAGG + Intergenic
1112437154 13:99398751-99398773 CTGTGGAAATAAAGGGTGGAGGG - Intergenic
1112709146 13:102106569-102106591 CTGTCGAAAAAGAGGGAGGGAGG + Intronic
1112763707 13:102718610-102718632 CTGTGGAAACAGAGCCAGGTTGG + Intergenic
1114525323 14:23364490-23364512 AAGAGAAGACAGAGGGAGGAGGG - Intronic
1114713785 14:24804174-24804196 CTGTGGAAACAGCAGAAGGAAGG - Intergenic
1114920055 14:27314737-27314759 CTGTGAATACATAGTGAGCATGG + Intergenic
1115085741 14:29512993-29513015 CTGTGAAAGCAGCTGGAGGGAGG - Intergenic
1115434437 14:33357165-33357187 ATGTGAAATTAGAGGGAAGATGG + Intronic
1116147927 14:41099567-41099589 CTGTGACTTCAGAGGGTGGAAGG + Intergenic
1116370531 14:44125067-44125089 CTTTGAAAATGGAGGAAGGAGGG - Intergenic
1116607414 14:47018913-47018935 ATGTGAACACAGAGGACGGACGG - Intronic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117187453 14:53254978-53255000 ATGAGAAAATAGGGGGAGGAAGG + Intergenic
1117474728 14:56082465-56082487 CTCTGAGATCAGAGGAAGGAGGG + Intergenic
1118198519 14:63650499-63650521 CTTTGAAACCAGAGGGTGGGTGG + Intergenic
1118685998 14:68291861-68291883 CTGTGAACAGACAGGGAGAAGGG - Intronic
1118971889 14:70643751-70643773 CTGGGAAGACAGAGGTAGGCTGG - Intronic
1119081085 14:71694343-71694365 CAGTGAAAACAGAGAGTTGAAGG - Intronic
1119228498 14:72961979-72962001 CTGTTAGAACAGAGGGAAGTGGG - Intergenic
1119662095 14:76459410-76459432 CTGGAGAAACAGAGGGTGGAGGG + Intronic
1120768969 14:88358126-88358148 GTGTGAAAACCAAGGGAGGCAGG + Intergenic
1120823362 14:88933224-88933246 GTGTGAAGTCAGTGGGAGGAGGG + Intergenic
1120873756 14:89360413-89360435 AGGTAAAAAGAGAGGGAGGAAGG + Intronic
1121638507 14:95469927-95469949 CTTTGATAACAAAGGTAGGAGGG - Intronic
1121775035 14:96584754-96584776 CTGTGAGGACTGAGGGAGGGTGG + Intergenic
1122034321 14:98936406-98936428 CTGATAAAAGAGAGGCAGGAGGG + Intergenic
1122122288 14:99561009-99561031 CTGTGGAGACTGAGGGAGGCAGG - Intronic
1122147277 14:99699115-99699137 CTCTGAAACCAGAGTGAGAAGGG - Intronic
1122168752 14:99853343-99853365 CAGTGGAAACAGGGGCAGGAGGG + Intronic
1122232624 14:100314287-100314309 CTGTGCAAACGGAGGGTGGCAGG + Intergenic
1123181891 14:106479231-106479253 GTGAGAGAAAAGAGGGAGGAAGG - Intergenic
1202945014 14_KI270726v1_random:17498-17520 GTGAGAGAAAAGAGGGAGGAAGG + Intergenic
1124081647 15:26504276-26504298 CTGTCAAAACAGTGGAAGGCAGG - Intergenic
1124099128 15:26677187-26677209 CTGTGATTTCAGAGGTAGGAAGG + Intronic
1124639638 15:31389498-31389520 ATGTAAACACAGGGGGAGGAGGG - Intronic
1125518862 15:40337447-40337469 CTGTGTAGACAGAGGGAGTCAGG + Intronic
1126314582 15:47356628-47356650 CTGTGAAATGAGAGGGATGAAGG - Intronic
1126942397 15:53780941-53780963 CTGTGAAAGCAGCTGGAAGAAGG - Intergenic
1126946230 15:53823471-53823493 AAGAGAAAACAGAGGGAGGAAGG + Intergenic
1127440445 15:59001247-59001269 CTCTGAGAACAGAGGTATGAAGG + Intronic
1127965700 15:63921354-63921376 CTGAGGAAACAGGGAGAGGATGG - Intronic
1128291014 15:66478208-66478230 CTGTGAGGACAGAGAGAGTAAGG - Intronic
1128305243 15:66594020-66594042 GTCTGAAAGCAGAGTGAGGATGG + Intronic
1128368018 15:67018433-67018455 CTGGGAACACAGATGGAAGAAGG - Intergenic
1128904177 15:71452455-71452477 CTTTGAGAGCTGAGGGAGGAGGG - Intronic
1130148256 15:81292028-81292050 CAGGGTAGACAGAGGGAGGACGG + Intronic
1130764621 15:86857435-86857457 ATGTGAAAACAGATGAAAGAAGG - Intronic
1131233077 15:90673627-90673649 CTCTGAAGAAAGAGGGAGGGAGG - Intergenic
1131302929 15:91215349-91215371 CTGCTAAAACAGAAGGAGGAGGG - Intronic
1131304507 15:91229926-91229948 TTTTTAAAACAGAGAGAGGATGG - Intronic
1131314154 15:91318038-91318060 CTGTGGAAGCAGAGGCTGGAGGG - Intergenic
1131371183 15:91883176-91883198 CTGTTAAAAAAGGGGAAGGAGGG - Intronic
1132758161 16:1495998-1496020 CAGGGAAAACAGAGCGAGCATGG - Intronic
1132858856 16:2060186-2060208 CTGTGAGCACAGAACGAGGACGG - Intronic
1133689548 16:8199993-8200015 ATGTGAGAAGAGAGGGAGGGAGG - Intergenic
1133698284 16:8285873-8285895 AGGTAAAAAGAGAGGGAGGATGG - Intergenic
1133761166 16:8799305-8799327 CTGGGAAGAAAGATGGAGGAAGG - Intronic
1135137339 16:19894953-19894975 ATGTGAAAACAGAGAGAGAGAGG - Intergenic
1136165012 16:28447970-28447992 CTGTGGAAAGTGAGAGAGGAAGG - Intergenic
1136214300 16:28781187-28781209 CTGTGGAAAGTGAGAGAGGAAGG + Intergenic
1136363225 16:29795102-29795124 CTGTGAAAGCAGGCAGAGGAAGG + Intronic
1136398005 16:30003509-30003531 CTGTGAAGACAGAAGCAGGTTGG + Intronic
1137396363 16:48118276-48118298 CAGAGAAAACCGAGGGAGGAGGG - Intronic
1137489312 16:48918418-48918440 CTGTGAAAACAGAGTTGGGAGGG - Intergenic
1137495374 16:48965313-48965335 CTGTGTAGACAGATGAAGGAGGG + Intergenic
1137824935 16:51484809-51484831 ATGGGAAAACAGAGAGAGAAAGG - Intergenic
1138074177 16:54024656-54024678 ATGGGAAAACCGAGGGAGAATGG - Intronic
1138085960 16:54134166-54134188 CTGTTTAAACACAGGGAGGGAGG + Intergenic
1138354173 16:56364546-56364568 CTCTGAAAACAGAGGTAAAAAGG + Intronic
1138913905 16:61439401-61439423 ATGTAAAAAGAGATGGAGGATGG + Intergenic
1138967307 16:62100247-62100269 TTGTGATATCAGAGGGAGAAAGG - Intergenic
1139221163 16:65183676-65183698 CAGAGAAATCAGAGTGAGGATGG - Intergenic
1140107379 16:71973176-71973198 CTGGGCAAAAGGAGGGAGGAGGG - Intronic
1140254351 16:73322125-73322147 CTCGGAGAGCAGAGGGAGGAAGG + Intergenic
1140257516 16:73349758-73349780 GAGGGAAAAAAGAGGGAGGAAGG - Intergenic
1140783673 16:78319157-78319179 CTTTGAAAATGGAGGGAGGCGGG + Intronic
1140808175 16:78552783-78552805 CAGAGAGAACAGAGGGAGAAAGG - Intronic
1141466906 16:84212271-84212293 CTGTGTCAACAGGGCGAGGAAGG - Intergenic
1141902636 16:87002684-87002706 TGGGGAGAACAGAGGGAGGAAGG - Intergenic
1142249410 16:88984223-88984245 CTGTGAACACCCAGGCAGGACGG - Intergenic
1142269157 16:89080134-89080156 TGGAGAAAGCAGAGGGAGGAAGG + Intergenic
1142549667 17:731164-731186 CCGTGAAATGAGAGGGAGGCTGG - Intergenic
1144798307 17:17907532-17907554 CTGTGAAATCAGAGAGAAAATGG + Intronic
1144825060 17:18101116-18101138 GTGTGCAAGCAGAGGCAGGATGG + Intronic
1146426122 17:32740952-32740974 CTGTGTAAATGAAGGGAGGAAGG - Intronic
1147205587 17:38835186-38835208 CTGTTAGAACAGAGGGAAGTGGG + Exonic
1147356033 17:39897485-39897507 TTCAGAAAGCAGAGGGAGGAGGG + Intergenic
1148330385 17:46810581-46810603 ATGAGAAAACTGAGGGAGGGAGG + Intronic
1148462376 17:47846119-47846141 CTGTGAGATGAGGGGGAGGAAGG + Exonic
1148571982 17:48677685-48677707 CTGTGAAAAAGGAGGGAGGGAGG - Intergenic
1149393255 17:56213521-56213543 CAAGGAAAACAGAGGGAGGCAGG + Intronic
1150378326 17:64700713-64700735 CTGTGAAAACAGAGTAGGGATGG + Intergenic
1150434726 17:65144966-65144988 ATGTGAGAACAGAGAGAAGACGG - Intronic
1151022397 17:70632456-70632478 ATGTCATAAAAGAGGGAGGAGGG + Intergenic
1151161217 17:72167355-72167377 CTGTGGAAGCAGTGGCAGGAGGG - Intergenic
1152223120 17:79080139-79080161 CTTTGAAAACTGTGGGTGGAGGG + Intronic
1152376403 17:79920982-79921004 CTGAGAAAACAGAGGTGGCAAGG - Intergenic
1152573408 17:81130212-81130234 CTGGGAACACAGAGGCAGGAGGG - Intronic
1152905025 17:82965298-82965320 CTGGGACAACAGAGGGAGAAGGG - Intronic
1152956079 18:43427-43449 CTCTGGAATCAGATGGAGGAAGG + Intergenic
1153463974 18:5368215-5368237 GTGTGAAAGGAGAGGGAGGAAGG - Intergenic
1153700959 18:7692690-7692712 CAGTGAAAACAGAGGAAGATAGG - Intronic
1154326769 18:13396865-13396887 CTGTGGATACAGAGGGCTGACGG + Intronic
1155391701 18:25345130-25345152 CTTTAAAAATAGAGGGAGGCAGG + Intronic
1155488573 18:26373788-26373810 CTGGGTGAACAGAGGGAGGGAGG - Intronic
1155731558 18:29166064-29166086 CTGTGAACACAGAGAGTAGAGGG - Intergenic
1157273526 18:46294363-46294385 CTGCCAAAAAAGAGGGAAGAGGG - Intergenic
1157301676 18:46484016-46484038 CTTGGAGAGCAGAGGGAGGAGGG + Intronic
1157378558 18:47189838-47189860 CTGTGAAGGCAGAGGGTTGAGGG + Intergenic
1157824736 18:50802542-50802564 CAGGTAAACCAGAGGGAGGAGGG + Intronic
1157871692 18:51235366-51235388 CTGTGAAAATGGAGGGAAGATGG - Intergenic
1158257750 18:55572407-55572429 CTGAGAAAATGGAGTGAGGAGGG + Intronic
1158367696 18:56757172-56757194 ATGGGAAAACAGAAGTAGGAAGG + Exonic
1159122512 18:64187248-64187270 CTGTGGAAACTCAGGGAGAATGG + Intergenic
1161002555 19:1918104-1918126 CTGCGAAGAGAGAGGGAGGACGG - Intronic
1161037531 19:2093738-2093760 CTGTGGAAAGAGAGGGAGCTGGG + Intronic
1161458511 19:4382137-4382159 CTCTGACAATGGAGGGAGGAGGG - Intronic
1161576697 19:5058401-5058423 CTCTGAGGACTGAGGGAGGAGGG + Intronic
1161634196 19:5377060-5377082 CTGTGAGAACATGTGGAGGAAGG + Intergenic
1161676248 19:5651681-5651703 GTGAGAAAGCACAGGGAGGAGGG - Intronic
1161737942 19:6002951-6002973 CAGGGACAACACAGGGAGGAGGG + Intronic
1161920046 19:7259191-7259213 CTGTAAAAAGAAAGGAAGGAAGG - Intronic
1162810997 19:13164251-13164273 ATCTGAAATCAGATGGAGGAGGG + Intergenic
1163755738 19:19105343-19105365 CCCAGAAAACATAGGGAGGAAGG + Intronic
1164520190 19:28973187-28973209 CAGTGACACCAGAGGGAGGAGGG + Intergenic
1165369948 19:35398786-35398808 TTGGGAGAACAGAGGAAGGAAGG - Intergenic
1165412877 19:35673209-35673231 CTGGGGAGACAGAGGGAGGACGG - Intronic
1165423186 19:35732375-35732397 CTGTGACGACTGAGGTAGGAGGG - Exonic
1165462521 19:35952542-35952564 ATGTGAGTACAGAGGCAGGAAGG - Intergenic
1165934921 19:39383476-39383498 CTGTGGTAAGAAAGGGAGGAAGG - Intronic
1166207456 19:41280886-41280908 ATTTGAAAAGAAAGGGAGGAAGG - Intronic
1166226898 19:41401599-41401621 CTATGATAACAGAGACAGGAAGG - Intronic
1166235087 19:41449921-41449943 ATGTGATAACAGAAGTAGGAGGG + Intergenic
1167528825 19:50002153-50002175 CGATGAGAACAGAGGAAGGAGGG - Intronic
1167557351 19:50204535-50204557 ATGTGGAAACTGAGGCAGGAAGG - Intronic
1167733641 19:51277932-51277954 CTGAGTAAACAGGCGGAGGAAGG + Intergenic
1168296528 19:55379728-55379750 CAGTGAAGACAGAAGGAGGCCGG + Intronic
1168428303 19:56257310-56257332 CTGGGAGAACAAAGGGAGGCAGG + Intronic
925436544 2:3843106-3843128 CTGTGATAGCAGGGGGAGAAGGG + Intronic
926135038 2:10330571-10330593 GTGTGAGAACAGAGGGAGAAAGG - Intronic
926390884 2:12391427-12391449 CTATAAAAAGAGAGTGAGGAGGG - Intergenic
926746338 2:16161435-16161457 CTGGAAATACACAGGGAGGATGG + Intergenic
926924585 2:17974449-17974471 CTGTGAAAATATAGCAAGGATGG - Intronic
927464746 2:23328747-23328769 CAGTGAAACCAGAGGGAGGCAGG - Intergenic
929066369 2:37979209-37979231 GTGTGAAAACGAAGGGTGGAGGG + Intronic
929825977 2:45310071-45310093 CTGAGAAGACTCAGGGAGGATGG - Intergenic
929834478 2:45382489-45382511 ATGGGGTAACAGAGGGAGGAAGG - Intergenic
930606570 2:53499199-53499221 CGGGGAAAAGAGAGGGAGGCAGG + Intergenic
930673573 2:54176942-54176964 CTGTGAAAGGAGAGGGAAGCTGG - Intronic
930751984 2:54943242-54943264 CTCTGAGAAGAGAGGGAAGAAGG - Intronic
931170621 2:59799877-59799899 CTGTGGAGATAGATGGAGGACGG + Intergenic
931692558 2:64847725-64847747 TAGTGCAATCAGAGGGAGGAGGG + Intergenic
933204447 2:79489398-79489420 CCATGAAATCACAGGGAGGAAGG - Intronic
933648843 2:84832859-84832881 CTCTGAAAAAACAGGGAGGCTGG + Intronic
933783860 2:85822563-85822585 ATGTGGAGAGAGAGGGAGGAAGG - Intergenic
933915242 2:86985081-86985103 CTGTTAAAACAGAACGATGAAGG - Intronic
934007751 2:87784820-87784842 CTGTTAAAACAGAACGATGAAGG + Intronic
934965369 2:98716987-98717009 CTGTGTATACAGAGGGCCGACGG + Intronic
935525768 2:104164668-104164690 GTGTGAAGACAGAGGAAGAAAGG - Intergenic
935771388 2:106425739-106425761 CTGTTAAAACAGAACGATGAAGG + Intronic
935787238 2:106560333-106560355 CTGGGAAAAAAGAGGGAGGGAGG - Intergenic
935908685 2:107870210-107870232 CTGTTAAAACAGAACGATGAAGG - Intronic
935995090 2:108762428-108762450 CTGTTAAAACAGAACGATGAAGG - Intronic
936073878 2:109389291-109389313 CTGTGCAAACAGGAGGAAGAGGG + Intronic
936130468 2:109835324-109835346 CTGTTAAAACAGAACGATGAAGG - Intronic
936214229 2:110536161-110536183 CTGTTAAAACAGAACGATGAAGG + Intronic
936423366 2:112390720-112390742 CTGTTAAAACAGAACGATGAAGG + Intronic
937104474 2:119296904-119296926 CTTTGAAAACAAAGGGAGTTGGG - Intergenic
937715979 2:125033092-125033114 ATGTAAAAACAAAGTGAGGAAGG - Intergenic
938452242 2:131431659-131431681 CTGTGGAAGGTGAGGGAGGAAGG + Intergenic
939167080 2:138651757-138651779 GTGTGAGGACAGAGGCAGGAAGG + Intergenic
939219167 2:139280216-139280238 CTGTGAAGACAGGGAGAGGATGG + Intergenic
939818618 2:146927848-146927870 ATTTGAAAAGAGAGAGAGGAAGG + Intergenic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
942279651 2:174347264-174347286 CTTTGAAAACAGAGGAGGGGGGG + Intergenic
942371783 2:175293477-175293499 TTCTGGAAACAGAGGAAGGATGG - Intergenic
942929492 2:181472794-181472816 AGGGGAAAACAGAGGGAAGATGG - Intronic
943169830 2:184384656-184384678 ATGTGAGAACAGATGGAGAACGG - Intergenic
943238951 2:185360206-185360228 CTGTCAAAAAAAAGGGGGGAGGG + Intergenic
943286414 2:186007135-186007157 CTGTGAAAACAGAGAGAGGGAGG - Intergenic
944139056 2:196434967-196434989 CTGTGAACTCAATGGGAGGATGG - Intronic
944617400 2:201475854-201475876 AAGTGAAAATTGAGGGAGGAAGG + Intronic
944663007 2:201936819-201936841 TTGTCAGAACAGAGGGAAGAGGG + Intergenic
944938047 2:204590179-204590201 CTGTGAGGACAGAGAGATGATGG - Intronic
945136835 2:206638666-206638688 CCTTGAAAACAGAGGGAGAAAGG - Intergenic
945942668 2:215965470-215965492 CAGGGGATACAGAGGGAGGAAGG + Intronic
946166196 2:217865432-217865454 ATGTGCAGACAGAGAGAGGAAGG + Intronic
946203898 2:218089664-218089686 CTGTGCTCACAGAGGAAGGAGGG - Intronic
946440297 2:219689396-219689418 TTGTGGAAGGAGAGGGAGGACGG - Intergenic
946613020 2:221479411-221479433 CTGTGAAAACAGAGCAAAGATGG + Intronic
947396743 2:229694468-229694490 CTGTGAAAGCAGACAGAAGAGGG + Intronic
947576481 2:231279017-231279039 CTGTGGCAACAGAGAGTGGATGG - Intronic
947678304 2:232005642-232005664 CAGGGTAAACAAAGGGAGGAAGG - Intronic
947876640 2:233471881-233471903 CTGTGCAGAGAGAGGCAGGAAGG + Exonic
948078267 2:235183924-235183946 CTGTGGAGAGACAGGGAGGAAGG - Intergenic
948307552 2:236960488-236960510 ATGTGAAGACACAGGGAGGTCGG + Intergenic
948786886 2:240357347-240357369 CTGTGCAAACGGAGGGCCGAGGG - Intergenic
1168832562 20:854607-854629 CGGTGGACACTGAGGGAGGAGGG - Intronic
1169200151 20:3705363-3705385 CTGAGAAAACAGAGCCAGGCAGG + Intronic
1169358027 20:4924288-4924310 CTCTGACTCCAGAGGGAGGACGG - Intronic
1169524027 20:6403402-6403424 GTATGTGAACAGAGGGAGGAAGG + Intergenic
1170803096 20:19606679-19606701 CTGAGAATGCAGAGGGAAGAAGG + Intronic
1170942877 20:20863581-20863603 CTGTGGAAGCAGAGAGAGGGCGG + Intergenic
1171304269 20:24091899-24091921 CAGGGAAAGGAGAGGGAGGAGGG - Intergenic
1172061034 20:32187709-32187731 CTCTGCAAGCAGGGGGAGGAGGG + Intergenic
1172423958 20:34842391-34842413 CTGTGAAAGGAGGGGAAGGAAGG + Intergenic
1172885272 20:38226827-38226849 CTCTGAAAACAAAGGGAGGAGGG + Intronic
1172900928 20:38334408-38334430 CCTGGAAATCAGAGGGAGGATGG - Exonic
1173317886 20:41961395-41961417 CTGTGGAGACACAGGGAGGCAGG - Intergenic
1173619514 20:44426067-44426089 CTGTGGAATCAGGGGGAAGATGG + Intronic
1173827865 20:46058726-46058748 CTGGGACAAGTGAGGGAGGAGGG + Intronic
1174073718 20:47917102-47917124 CTGTGAAAACATGGGGTTGATGG + Intergenic
1174102359 20:48137407-48137429 CTGGGACCACAGAGGAAGGAGGG - Intergenic
1174559416 20:51419421-51419443 ATGGGAAAAAAGAGGAAGGAGGG - Intronic
1174846463 20:53948120-53948142 CTGGGCAAACAGAGGCAGGATGG - Intronic
1175376546 20:58529927-58529949 TTGTGAAAAAAAAGGAAGGAAGG - Intergenic
1175767230 20:61599898-61599920 CTTGGAAAATAAAGGGAGGAAGG + Intronic
1176427015 21:6554230-6554252 CTGTGAAACCAGAGCGAAAACGG - Intergenic
1176957605 21:15124190-15124212 CTGGGTAAACAGAGGTAAGACGG + Intergenic
1177435403 21:21045539-21045561 CTCGGAAAACTGAGGCAGGAGGG + Intronic
1178417462 21:32415367-32415389 CTGTGAAGGAGGAGGGAGGATGG + Intronic
1178467831 21:32864752-32864774 CTGGGAGAACAGTGGAAGGAAGG - Intergenic
1178700521 21:34829746-34829768 GTTTGAAAACAAAGGGAGTAGGG - Intronic
1178705375 21:34868534-34868556 CAGAGAAAGCAGAGTGAGGAAGG - Intronic
1178928981 21:36800556-36800578 GTGAGGAAACAGAGGCAGGAAGG + Intronic
1179124107 21:38576639-38576661 CTGTGACAGCAAAGGGAGGTTGG - Intronic
1179551164 21:42144914-42144936 GTATGGAAACAGAAGGAGGAAGG + Intergenic
1179702506 21:43162552-43162574 CTGTGAAACCAGAGCGAAAACGG - Intergenic
1180036905 21:45254767-45254789 TTGTGAAAGCAGAGGGAGCCTGG + Intergenic
1180581565 22:16844179-16844201 CTCTGTAGGCAGAGGGAGGAGGG + Intergenic
1180931094 22:19592354-19592376 CTGTGGAAGCTGAGGCAGGAGGG - Intergenic
1181928946 22:26383801-26383823 CTGAGCTAAGAGAGGGAGGATGG - Intergenic
1184515140 22:44957096-44957118 CTGTGAGCTCAGAGGGAGGAGGG - Intronic
1184576758 22:45374839-45374861 CTGTGAAAATAGGGGAAGGAAGG - Intronic
1184747255 22:46463594-46463616 CGGGGAAAACAGCTGGAGGATGG - Intronic
1185108696 22:48888724-48888746 CTGTGGAAACAAAGGCAGCAAGG + Intergenic
1185184236 22:49383074-49383096 ATATGAAAATTGAGGGAGGATGG + Intergenic
949184878 3:1178601-1178623 ATGAGAAAACAGTGGGGGGAAGG - Intronic
949764692 3:7513222-7513244 CTGTGAAAACACCAGGAGAAAGG - Intronic
949808751 3:7983560-7983582 CAATGAAAACAGAGAGAGGCTGG + Intergenic
949942192 3:9163575-9163597 CTGTCAAAGCAGAGGGGGCAGGG + Intronic
950313999 3:11984392-11984414 GTGTGAAGACAGATGGAGGGAGG - Intergenic
950467136 3:13162244-13162266 CTTGGAAGACAGAGGGAGAAGGG + Intergenic
950527025 3:13530226-13530248 CTGAGAAAACTGAGGCAGAAAGG - Intergenic
950658493 3:14452134-14452156 CTGTGAAAACAGAGGGAGGAAGG - Intronic
950674321 3:14545411-14545433 ATGTGAACACAGAGTCAGGAGGG + Intergenic
951614744 3:24529896-24529918 CTGTAAAAGCAGGGTGAGGAGGG - Intergenic
951630001 3:24709325-24709347 CTGTGAAAAAAGTGGGGAGAGGG + Intergenic
951922484 3:27871681-27871703 CTGGGAAGACACAGGGATGAGGG + Intergenic
952255104 3:31688205-31688227 GTGTGAGACCAGAGGGAGGTGGG - Intronic
952846433 3:37691410-37691432 CAGTGAAGACAGTGGGAAGATGG + Intronic
954876696 3:53807073-53807095 CTGAGAACACAGGTGGAGGAGGG - Intronic
954906469 3:54067514-54067536 AAGTGAGAAGAGAGGGAGGAAGG - Intergenic
955010480 3:55009798-55009820 CTGTGAAAACAGAAATAGAATGG - Intronic
955206474 3:56900129-56900151 CTGTGACAACAAAGGGAGTTGGG - Intronic
955672650 3:61418151-61418173 ATGAGAAAACAGAGGCAGGGAGG + Intergenic
956442232 3:69291754-69291776 CTCAGAAAACACAGGGATGAGGG - Intronic
956700233 3:71952332-71952354 CAGTGATGGCAGAGGGAGGAAGG - Intergenic
957273749 3:78063895-78063917 CCCTGAAAATAGAGGCAGGAAGG - Intergenic
957979766 3:87494144-87494166 CTAGGAAAAGAGAGGAAGGAAGG + Intergenic
958691762 3:97477909-97477931 CTGTGAAAAAATAGGTATGATGG + Intronic
958962358 3:100522409-100522431 CTGTGAATTCAGAAGGAGGATGG - Intronic
959239613 3:103773031-103773053 CTTAGAAAAGAGAGGTAGGAGGG - Intergenic
959970245 3:112400923-112400945 AAGAGAAAATAGAGGGAGGAAGG + Intergenic
960255897 3:115511311-115511333 ATGTGACAACAGAGGCTGGAGGG + Intergenic
960584484 3:119308471-119308493 CTTTGAAGACAGATGGAGGAAGG - Intronic
961231858 3:125320167-125320189 TTGAGAAAACAGAGGGAGGAAGG - Intronic
961318739 3:126057895-126057917 CTGTGGGGACAGAGGGAAGAGGG - Intronic
961486983 3:127223503-127223525 CTGTGAAGACAGATGTGGGAGGG + Intergenic
961662241 3:128475543-128475565 GGGTGCAAACAGAGGGAAGAAGG + Intergenic
961991042 3:131191386-131191408 CTTTGAAAATAGAGAAAGGAGGG - Intronic
962275712 3:134011871-134011893 GTGTGAGAACAGAGGGAGGCGGG + Intronic
962678110 3:137771002-137771024 CGGTGATAACCGAGGGAGGTGGG + Intergenic
962906607 3:139809137-139809159 CTTGGAAGACCGAGGGAGGAGGG + Intergenic
962974929 3:140437610-140437632 CTGTGACAACAGAAAGAGGCTGG + Intronic
962979865 3:140478763-140478785 AACTGAAAAAAGAGGGAGGAAGG + Intronic
963081729 3:141401651-141401673 CTGTCAAAACACAGGGAACATGG + Intronic
964101785 3:152996130-152996152 CTGTCAAAAGAAAGGAAGGAAGG + Intergenic
964172635 3:153789373-153789395 CTGTGAGAACTGAGGTTGGATGG - Intergenic
964705167 3:159610547-159610569 TAATGAAAACAGAGGGAGGTAGG - Intronic
965297145 3:166962448-166962470 CTGTGAAAACACAGAGAAGTTGG - Intergenic
965448746 3:168809947-168809969 CTGTGAAGACAGAAAGGGGAAGG - Intergenic
965511538 3:169573138-169573160 CTGTGAAAGCAGAGGGTGAGGGG - Intronic
965716144 3:171605259-171605281 CAGTGAAAAGAAACGGAGGAGGG + Intronic
967538506 3:190635969-190635991 CTGTGAAAACCGAGGGAATGGGG + Intronic
967653242 3:192012778-192012800 CTGAGAAAACAAAAGGAGCAAGG - Intergenic
967828265 3:193896293-193896315 CGGGGAAGACACAGGGAGGAGGG + Intergenic
968006571 3:195247244-195247266 CTGTGAAATCTGAGGGTGGTCGG + Intronic
968538263 4:1148783-1148805 CTGTGGAGACTGAGGCAGGAGGG - Intergenic
968563902 4:1299308-1299330 CTGTGACAACAGAGGCATCAAGG - Intronic
969282721 4:6181938-6181960 CTGTGCAGACAGGAGGAGGAGGG + Intronic
969323033 4:6424541-6424563 CTGTGGATACACAGGGAGGCCGG + Intronic
969761981 4:9193143-9193165 CTGTGAGAACAGAGAGTGAAGGG + Intergenic
970083462 4:12317171-12317193 CTATGAAAACAGAGACAGCATGG - Intergenic
970254417 4:14152845-14152867 GTGTGAAATCAGAGTGAGGTGGG - Intergenic
970365211 4:15351258-15351280 AGGAGAAAACAGAGGAAGGAAGG - Intronic
970486703 4:16531912-16531934 CAGTTCAAACAGATGGAGGAAGG + Intronic
971155301 4:24075271-24075293 CTGTGAAAACACAGAGATGGTGG + Intergenic
971537892 4:27777401-27777423 CTCTGAAGGCTGAGGGAGGAGGG + Intergenic
973139541 4:46749404-46749426 TTGGGAAAATAGATGGAGGATGG - Intronic
973711252 4:53632269-53632291 CTGTGAGAGAAAAGGGAGGATGG - Intronic
974037288 4:56827985-56828007 CTGTGAAAGCAGTGGGAGGGAGG + Intergenic
974587279 4:63895994-63896016 CTGTGAAAACAGTGAGAGGGTGG - Intergenic
975084498 4:70321414-70321436 ATGTGAAACCAGAAGGAGAAAGG - Intergenic
976022976 4:80653086-80653108 CTGAGAAAAGAGATGTAGGATGG - Intronic
976317471 4:83673826-83673848 CTGTGAAAGCAGGGAGAGGAGGG - Intergenic
976795367 4:88926035-88926057 GGGTGATAAGAGAGGGAGGAAGG + Intronic
977014034 4:91670161-91670183 CTGTGAAAGCAGCTGGAAGAAGG - Intergenic
977102536 4:92835249-92835271 GTGTCAAAACAAAGGTAGGAAGG + Intronic
977888664 4:102281330-102281352 ATGAGAAAACAGGGGTAGGATGG + Intronic
978338259 4:107693216-107693238 CTGTGAAAACAGGAACAGGAGGG + Intronic
978464048 4:108988612-108988634 CTTTGAAGTCACAGGGAGGAGGG - Intronic
978940900 4:114434954-114434976 CTGGCAAAGCAGAGTGAGGAAGG + Intergenic
979891328 4:126098893-126098915 CTGTGAAAAGATAGAGAGCAGGG + Intergenic
979987585 4:127333983-127334005 CAGTGCAAACAGAGGAAGGGAGG - Intergenic
981348879 4:143705130-143705152 GTGTGAAAAAAGAGGGAAGAGGG + Intergenic
982302863 4:153898041-153898063 AAGAGAGAACAGAGGGAGGAGGG - Intergenic
982434415 4:155367269-155367291 CAGAGAAAACACAGGGAAGAAGG + Intronic
982736642 4:159013550-159013572 AGGTGAAGACAGAGAGAGGAAGG + Intronic
984100696 4:175481985-175482007 ATGTGAAAACAGAGGAAAGATGG - Intergenic
984736478 4:183113268-183113290 ATGTAGAAACAGAGGGAGGAGGG + Intronic
984944878 4:184963025-184963047 CAGGGAAAACTGAAGGAGGATGG - Intergenic
985440186 4:189978252-189978274 CTCTGGAATCAGATGGAGGAAGG + Intergenic
985475334 5:75616-75638 CTGTGAAAACACCGGGTGGATGG + Intergenic
985549443 5:525529-525551 CCGTCCAAACAGAGGGAGCAGGG - Intergenic
985762187 5:1755006-1755028 GTGTGAGGACACAGGGAGGAGGG + Intergenic
986339526 5:6777305-6777327 CAGAGAAAGCAGAGGGATGAAGG - Intergenic
986704825 5:10446339-10446361 TTGTCACAACAGAGGGTGGATGG - Intronic
987759088 5:22135917-22135939 CAGTGAAAACAGAGTCAAGAGGG - Intronic
988785564 5:34563263-34563285 CTGTGAAATTAGAGGGCTGAGGG + Intergenic
989243284 5:39224344-39224366 CTGTGAAAACAGATGGGGGAGGG + Intronic
989299765 5:39876976-39876998 CAGAGAAAAAAGAGGAAGGAGGG + Intergenic
989723315 5:44554991-44555013 CTGTGAAAACAGAGGGAATTAGG + Intergenic
989723330 5:44555336-44555358 CTATGAATACAGAGCGTGGATGG + Intergenic
990635984 5:57726764-57726786 CTCGGAAAACTGAGGCAGGAGGG - Intergenic
990951833 5:61305961-61305983 ATGAGAAAACAGAGGGATGGGGG - Intergenic
991040025 5:62165539-62165561 CCATTAAAACCGAGGGAGGAAGG + Intergenic
991619746 5:68533245-68533267 AGGTGAAAAGAGAGTGAGGAGGG + Intergenic
991893800 5:71369363-71369385 CAGTGAAAACAGAGTCAAGAGGG - Intergenic
992640564 5:78765327-78765349 CTGGGAAATCAGTGGGAGGATGG + Intronic
992872686 5:81022620-81022642 TGGAGAAAACAGAGGGAGGCAGG - Intronic
993347307 5:86800268-86800290 TTGTGAAAACAGAAGCAGAAAGG + Intergenic
993439035 5:87932500-87932522 CTCTGAAAACAAAAAGAGGAAGG + Intergenic
993895945 5:93534637-93534659 ATGAGAAAAAAGAGGTAGGAAGG + Intergenic
994796169 5:104302508-104302530 CTGTGTGAACAGAGGAAGCATGG - Intergenic
994949037 5:106432714-106432736 ATGTGAAAACATAGTGAGAAGGG + Intergenic
996215898 5:120865124-120865146 CTGTGAATACAGAAAGAGAATGG - Intergenic
996525491 5:124474672-124474694 TTGTGGAAACAGAGGGGGTATGG - Intergenic
997737495 5:136224783-136224805 CTGTGGAAGCAGAGGGTGGAGGG - Intronic
998023921 5:138796648-138796670 CTGGGAAATCAGTGGGAGAAGGG + Intronic
998516873 5:142763835-142763857 ATGGGAAAACAGAGGGAGCCAGG - Intergenic
999586230 5:153092688-153092710 CTGTGAGAGCAGAGGGAGCCAGG - Intergenic
999950558 5:156645296-156645318 CTGAGAAAACAGAGAGAGGATGG + Intronic
1000272283 5:159697449-159697471 AGGTGAAAACAGGGGCAGGAGGG - Intergenic
1000646179 5:163762963-163762985 TTGTGGAGAGAGAGGGAGGAGGG + Intergenic
1000707172 5:164526327-164526349 CTGTGATAGCAGAGTGAAGAGGG - Intergenic
1001270921 5:170311051-170311073 CTGTCATACCAGAGGCAGGATGG - Intergenic
1001818736 5:174693252-174693274 CTCTGGAAACACAGGGGGGAGGG - Intergenic
1001956408 5:175850930-175850952 CTGAGGAACCAGAGGCAGGAGGG + Intronic
1002829312 6:804803-804825 CTGTTAACAAAGAAGGAGGAAGG - Intergenic
1004929383 6:20447127-20447149 CTCTGAACACAGAGGAAGGAGGG + Intronic
1004945601 6:20609326-20609348 GAGGGAAAAGAGAGGGAGGAGGG - Intronic
1005089182 6:22038452-22038474 ATGTGAGAACAGTGAGAGGAAGG - Intergenic
1005851442 6:29825992-29826014 CTCTGAAGACTGAGGTAGGAGGG + Intergenic
1006187325 6:32188860-32188882 CTGAGAACAAGGAGGGAGGAGGG + Intronic
1006376957 6:33676994-33677016 CGCTGAAAGCAGAGAGAGGAAGG - Exonic
1006397870 6:33798752-33798774 CTGTGCAAACAGCTGGAGCAAGG - Intronic
1006646968 6:35521528-35521550 CTGTTAACACAGAGGGAAGTAGG - Intergenic
1006817674 6:36863911-36863933 CTGTGAAAGCAGAGGGGCGGAGG - Intronic
1006877249 6:37308517-37308539 CTGTGAAAACAAAGGGCTAATGG + Intronic
1006884918 6:37373366-37373388 TTATGAACACTGAGGGAGGAGGG + Intronic
1007018750 6:38497275-38497297 CTGTGACAGCAGTGGGAGGTGGG - Intronic
1007618356 6:43196035-43196057 ATGTGAAAGCAGAGTGAGGAGGG - Intronic
1008160533 6:48069519-48069541 CTGTGGAATCACAGCGAGGAAGG - Intergenic
1008502601 6:52198897-52198919 CTGAGAATACAGGGGGAAGAGGG + Intergenic
1009413799 6:63394952-63394974 CAGTGCACACAGAGGGAAGAAGG - Intergenic
1009428532 6:63540996-63541018 CTGTCAAAAAAAAGGAAGGAGGG + Intronic
1009497328 6:64367490-64367512 TTTTGGAAAGAGAGGGAGGATGG + Intronic
1009995757 6:70893444-70893466 CTGTGATAACTGTGGAAGGATGG - Intronic
1010756763 6:79674053-79674075 CTTTGGAAACAGAAGTAGGAAGG + Intronic
1011157731 6:84352026-84352048 CTGTGGAAAGGAAGGGAGGAAGG + Intergenic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1012193032 6:96303989-96304011 CTGTGAAAACACTGAAAGGAAGG + Intergenic
1013055085 6:106575419-106575441 CTGTGAGAACGTAGGGACGACGG + Intronic
1013299873 6:108794963-108794985 ATGTGAAGACAGAGAAAGGAAGG - Intergenic
1013677963 6:112488205-112488227 CTGTGATAGGAAAGGGAGGAAGG - Intergenic
1015056810 6:128912346-128912368 TTGTGTAAAAAGAGGGAGAAAGG - Intronic
1015348724 6:132191637-132191659 AGGTGAAAATAGAGAGAGGAGGG + Intergenic
1015969557 6:138730556-138730578 CTGTGAAAGCAACTGGAGGAAGG - Intergenic
1016166061 6:140945122-140945144 CTGTGAAAGCAGCAGGAGGAAGG + Intergenic
1016521458 6:144951341-144951363 CTGTGGATACTGAGGGATGATGG - Intergenic
1016841397 6:148529110-148529132 CTGTGAAAACAGATGAAGCTTGG + Intronic
1017097543 6:150817926-150817948 CTGTGAAAGAGGAGGGAGGGAGG - Intronic
1017103482 6:150867062-150867084 ATGGGAGAGCAGAGGGAGGAAGG - Intronic
1017996243 6:159534036-159534058 CTCAGCAAACAGAGTGAGGATGG + Intergenic
1018381388 6:163261125-163261147 CCGGGAAGACAGAGGGAGGAGGG - Intronic
1018907847 6:168085602-168085624 CTGTGAGAACAAAGGGACCAAGG + Intergenic
1019021900 6:168925852-168925874 CCGTGAAAACACAGGCAGGCCGG + Intergenic
1019169297 6:170122843-170122865 CTTTGAAGATAAAGGGAGGAGGG + Intergenic
1019289272 7:242438-242460 CTGAGAAAGCAGAAGGAGGAGGG + Intronic
1019293126 7:260061-260083 CAGTGAATTCAGAGGCAGGACGG + Exonic
1019587711 7:1814116-1814138 CTGTGAACACAGAGGGACAGGGG - Intergenic
1019647584 7:2139318-2139340 CTGTGAGCTCAGAGGGAGGGTGG - Intronic
1020184334 7:5947411-5947433 CTGTAAAAACAGATGAAGGTAGG + Intronic
1020298583 7:6777355-6777377 CTGTAAAAACAGATGAAGGTAGG - Intronic
1020982680 7:15091217-15091239 CTTAGCAAACAGAGGCAGGAAGG + Intergenic
1021304717 7:19018549-19018571 CTGTGAAAACAGTGCTAAGACGG + Intergenic
1021333523 7:19369186-19369208 CTGTGAAAACAGACATAGAATGG - Intergenic
1022494735 7:30845734-30845756 CTGTGAAAGCAGATGGAGGATGG + Intronic
1022540328 7:31128957-31128979 CTGTGGAGAAAAAGGGAGGAGGG - Intergenic
1022891676 7:34707466-34707488 CTGTGGAAACTGAGTGAGGCAGG - Intronic
1022909100 7:34882915-34882937 CTATGAAAGCAGCGGGAGGGGGG - Intergenic
1022936035 7:35178115-35178137 CTCTGAAAACAGAGATTGGATGG + Intergenic
1023682029 7:42696968-42696990 CTCTGAAACCAGAGGGAGCATGG + Intergenic
1024159915 7:46663516-46663538 CTGGGAAAGCAGAGGGAGTAAGG + Intergenic
1027185343 7:75967750-75967772 CGGTCCATACAGAGGGAGGAGGG + Intronic
1029150431 7:98476603-98476625 CTGAGAAATGAGAGGGAGCAGGG - Intergenic
1029369295 7:100137880-100137902 TTGCAAAAACTGAGGGAGGAAGG + Intergenic
1029585579 7:101468722-101468744 CTGGGGAAACTGTGGGAGGAGGG + Intronic
1029629212 7:101739916-101739938 CTGTGCAAACAGACTGAGGAAGG - Intergenic
1029831997 7:103270832-103270854 CTCTGAAAACAGAGATTGGATGG + Intergenic
1030187729 7:106779972-106779994 CTGTGGGAAAAGAGGGAGCATGG - Intergenic
1031835251 7:126673552-126673574 CTATAAAGACAGTGGGAGGATGG - Intronic
1032529279 7:132606757-132606779 CTGAGAAAAATTAGGGAGGAGGG + Intronic
1032534141 7:132646556-132646578 CTGTGAGGACACAGTGAGGATGG + Intronic
1033910092 7:146252538-146252560 ATGAGAAAATAGAGAGAGGATGG + Intronic
1034686038 7:152972328-152972350 CTGAGAGCACAGAGGCAGGAAGG + Intergenic
1034733122 7:153405129-153405151 CTGTCACGACAGAGGGAGGCAGG + Intergenic
1035194677 7:157206823-157206845 CTGTGAAAGCAGGAGCAGGATGG + Intronic
1035310953 7:157968515-157968537 CTGGAAAAACAGAAGGAGGCTGG - Intronic
1035417485 7:158702524-158702546 CTGGAAAAACACAGGCAGGATGG - Intronic
1035529321 8:338345-338367 CTGTGAAAACATGAGGAGTAGGG + Intergenic
1035576773 8:713074-713096 CTGTGACAACTGAGAGAGAACGG - Intronic
1035749610 8:1987167-1987189 GTGTAAAAACAGAGAGAGGAAGG - Intronic
1035979096 8:4348898-4348920 CTGTGATATCACAGGGAGAAAGG - Intronic
1036095142 8:5715787-5715809 CTGTGAAAGCAAGGGAAGGAGGG + Intergenic
1036272083 8:7315009-7315031 CTGTGAGAACAGAGAGTGAAGGG + Intergenic
1036349262 8:7995336-7995358 CTGTGAGAACAGAGAGTGAAGGG - Intergenic
1036673969 8:10813800-10813822 CTCCGAAACCAGAGTGAGGATGG - Intronic
1036844554 8:12155873-12155895 CTGTGAGAACAGAGAGTGAAGGG - Intergenic
1036865924 8:12398206-12398228 CTGTGAGAACAGAGAGTGAAGGG - Intergenic
1037077402 8:14737665-14737687 ATATGAAAACAGACAGAGGATGG - Intronic
1037192430 8:16142824-16142846 CTGGGAATACAGAGGGAGGGAGG + Intronic
1037522486 8:19693360-19693382 CTGGTAGAACAGAGAGAGGATGG - Intronic
1037622160 8:20574052-20574074 CTGTGAAGAAAAAGGAAGGAGGG - Intergenic
1037793480 8:21969460-21969482 CTGTGAAAAGAGAGGGAAAAAGG - Intronic
1037916047 8:22774056-22774078 CTGTGAAACCAGCAGGAGGGAGG - Intronic
1038954102 8:32448680-32448702 CTGTGTAAACAATGGGAGGGAGG + Intronic
1039309279 8:36298005-36298027 CTGTGAAAACAGCCGGAGTGGGG + Intergenic
1040435043 8:47381913-47381935 CTGGTAGAACAAAGGGAGGATGG - Intronic
1040640140 8:49323613-49323635 CTGTCAAAACAGAGTGAGTCTGG + Intergenic
1041240323 8:55843645-55843667 CTGTGAAGACAGAGAAAAGATGG + Intergenic
1041731708 8:61069420-61069442 AAGGGAAAACAGAGGAAGGAAGG - Intronic
1042266079 8:66910378-66910400 CTGTGAAAGCAGTGGGGAGAGGG + Intronic
1042420662 8:68584881-68584903 CTGTGGAGCCAGAGGGAGAAGGG - Intronic
1043511699 8:80956609-80956631 CTGGGAACACTGAGGGTGGAGGG + Intergenic
1044571985 8:93730232-93730254 CTGCAAAAACAGAGGCAGCAAGG + Exonic
1044573326 8:93743320-93743342 CTGTGTGAATAGAAGGAGGATGG - Intergenic
1044628059 8:94253925-94253947 TTGTGAAAATAGAGTGGGGATGG - Intronic
1045622377 8:103995461-103995483 CAGTGGAGACAGAGGGAGAATGG + Intronic
1047009363 8:120654288-120654310 CTAGGAAAAAAGAGGGAGGGAGG + Intronic
1047167686 8:122458420-122458442 CAGTGGAAACAGTGGGTGGAGGG + Intergenic
1047172155 8:122504128-122504150 CTCTGAAAACAGAGGGAATTGGG + Intergenic
1047498727 8:125426833-125426855 CTGTGGGAAGAGGGGGAGGAAGG + Intergenic
1047729631 8:127716226-127716248 CTGAGAAAACAGAGTAAGCAAGG - Intergenic
1048538276 8:135317905-135317927 CTGTGAGAACAGTGGATGGAAGG - Intergenic
1048646035 8:136420796-136420818 CTGTAAACACCGAGGGAGAATGG + Intergenic
1048773242 8:137918483-137918505 CTTCGAAGACAGAGGCAGGAGGG + Intergenic
1049186534 8:141257723-141257745 TTGCGACAACAGGGGGAGGAGGG + Intronic
1049738674 8:144223522-144223544 CTGAGAAACCAGAGGGAGCCAGG - Intronic
1050308171 9:4327245-4327267 CTGAGAGAGCAGAGGGAGGTGGG + Intronic
1050545604 9:6706293-6706315 CTTTGAATACAGTGGGAGGCAGG + Intergenic
1051235971 9:14999543-14999565 CTGTGAATAGAGAAGGAAGATGG + Intergenic
1051309852 9:15758180-15758202 CCTTGAAAACAGCTGGAGGAAGG + Intronic
1051755924 9:20400281-20400303 ATGTGAAAAAAGAGAGATGAGGG + Intronic
1052216368 9:25971691-25971713 CTGAGAAAACAGAGGCAGAAGGG - Intergenic
1052635189 9:31093932-31093954 CTTTGATACCAGAGGGAGAAAGG - Intergenic
1055307705 9:74947378-74947400 CTGGGAAAACAGGGGGAAGCAGG + Exonic
1057045454 9:91882789-91882811 ACGTGAAAACAGAGGGAGAAAGG + Intronic
1057218364 9:93242148-93242170 CTGTGATAGCACAGTGAGGATGG + Intronic
1058120731 9:101135833-101135855 CTGGGCAGACAGAGGCAGGAAGG - Intronic
1058352627 9:104043966-104043988 ATGGGAAAAGAGAGGCAGGAGGG + Intergenic
1058669867 9:107351758-107351780 GTGTGCTCACAGAGGGAGGATGG + Intergenic
1058806186 9:108594344-108594366 ATGAGAAAACTGAGGGATGAGGG - Intergenic
1058855734 9:109060122-109060144 CCGTGACAACAGACTGAGGATGG + Intronic
1059217203 9:112575148-112575170 CTGTGTTAACTGAGGGAGAAAGG - Exonic
1059404464 9:114091573-114091595 GTGGGAAATTAGAGGGAGGAAGG - Intronic
1059943518 9:119381948-119381970 CTAAGAAAACACAGGGAGAAAGG - Intergenic
1060216196 9:121739922-121739944 CTGTGAGAACAGAGGAAAGCTGG + Intronic
1060273930 9:122167935-122167957 CGATGAAAGCAGAGGGACGAAGG - Intronic
1060445280 9:123681444-123681466 CTGTAAAAACAGGGTGAGGAGGG + Intronic
1060522149 9:124300057-124300079 CTGAGGACACAGAGGGAGAAGGG + Intronic
1060975607 9:127763150-127763172 CCCTGAATAAAGAGGGAGGAGGG - Intronic
1061091310 9:128428152-128428174 CTGTGGGACCAGAGGGAGAAAGG - Intronic
1061295311 9:129673861-129673883 CTGTTTAGACAGAGGGAGGTTGG + Intronic
1061404522 9:130385987-130386009 CTGAGGAAACCGAGGCAGGAAGG - Intronic
1062024534 9:134334186-134334208 CTGGGAAAAAAGAGGCTGGATGG - Intronic
1062315292 9:135964231-135964253 CTGGGGGAACAGAGAGAGGAGGG + Intergenic
1062322102 9:135995106-135995128 CTGTGGAGACAGACGGTGGAGGG - Intergenic
1185609960 X:1388389-1388411 CTGTGAGGACACAGGGAAGACGG + Intronic
1185645249 X:1610997-1611019 CTTTGAAATCCGAGGCAGGAGGG - Intergenic
1186115178 X:6297800-6297822 ATGTGGAAACAGAACGAGGAAGG + Intergenic
1186253298 X:7692329-7692351 ATGTGAAAACAGAGAGAAGACGG + Intergenic
1186817446 X:13251912-13251934 CTGTGAAAATGAAGAGAGGAGGG - Intergenic
1187071099 X:15889223-15889245 CTGTAAGAACAAATGGAGGAGGG + Intergenic
1187555540 X:20347858-20347880 CTGTGAAAGCAGAGGAGGAAGGG - Intergenic
1187680550 X:21763294-21763316 CTGGGAAAGAAGAGGGAGCAAGG + Intergenic
1187946601 X:24432231-24432253 ATGTGACAGCAGTGGGAGGAAGG + Intergenic
1192088401 X:68125789-68125811 CTGAAAAAATAGAGGGGGGAGGG + Intronic
1192436192 X:71145181-71145203 CTGTGGAAATAGAGGGACCATGG - Intronic
1195150696 X:102066712-102066734 CTTTGAATAGAAAGGGAGGAAGG - Intergenic
1196093923 X:111777868-111777890 CTGTGGAAACACAGAGAGGAGGG - Intronic
1196310097 X:114153803-114153825 CAGAGAAAAGAGAGGGAGAATGG + Intergenic
1196642230 X:118075484-118075506 CTAAGAAAAAAGAGAGAGGAAGG + Intronic
1198110861 X:133501653-133501675 CTGGGAAATCAGAGGCAAGATGG - Intergenic
1198258973 X:134949620-134949642 ATGTGAAGCCAGAGAGAGGAAGG - Intergenic
1198912875 X:141633906-141633928 CTGTGAAAACAGCTGGGAGAGGG + Intronic
1199321172 X:146440990-146441012 AAGAGAAAACAGGGGGAGGAAGG + Intergenic
1199490007 X:148387594-148387616 AAGTGAAAACAGAGGTAGGCAGG - Intergenic
1199887163 X:152031606-152031628 CTTTGAATACAGTGGGAGGCAGG + Intergenic
1200766373 Y:7083910-7083932 CTGTGAAATCCCAGGGAGGGTGG - Intronic
1201442246 Y:14020992-14021014 CTGTAAAAAAAGGGAGAGGAAGG - Intergenic
1201897177 Y:19004376-19004398 CTGGGAAAGCAGAGTGAGGAGGG + Intergenic