ID: 950658577

View in Genome Browser
Species Human (GRCh38)
Location 3:14452595-14452617
Sequence CCCCGCTCCCAGGTTACTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 117}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950658571_950658577 21 Left 950658571 3:14452551-14452573 CCCAAGTCCATGGTCACAGGTCA 0: 1
1: 0
2: 0
3: 19
4: 218
Right 950658577 3:14452595-14452617 CCCCGCTCCCAGGTTACTCTTGG 0: 1
1: 0
2: 1
3: 11
4: 117
950658572_950658577 20 Left 950658572 3:14452552-14452574 CCAAGTCCATGGTCACAGGTCAC 0: 1
1: 0
2: 1
3: 15
4: 130
Right 950658577 3:14452595-14452617 CCCCGCTCCCAGGTTACTCTTGG 0: 1
1: 0
2: 1
3: 11
4: 117
950658574_950658577 -9 Left 950658574 3:14452581-14452603 CCACATGTGTGTCTCCCCGCTCC 0: 1
1: 0
2: 0
3: 8
4: 203
Right 950658577 3:14452595-14452617 CCCCGCTCCCAGGTTACTCTTGG 0: 1
1: 0
2: 1
3: 11
4: 117
950658573_950658577 14 Left 950658573 3:14452558-14452580 CCATGGTCACAGGTCACATTGTG 0: 1
1: 0
2: 2
3: 27
4: 209
Right 950658577 3:14452595-14452617 CCCCGCTCCCAGGTTACTCTTGG 0: 1
1: 0
2: 1
3: 11
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950658577 Original CRISPR CCCCGCTCCCAGGTTACTCT TGG Intronic
900659805 1:3776785-3776807 CCCCCCTCCCATGTGGCTCTAGG + Intergenic
901061112 1:6472349-6472371 GCCCCCTCCCAGGTTCCTCTAGG + Intronic
901768329 1:11517836-11517858 CCCAGCTCCCAGGGTTCTTTGGG - Intronic
902833054 1:19029953-19029975 CCTGGCTCCCAGGTGACTGTGGG + Intergenic
904394926 1:30213699-30213721 CCCAGCTCCCATGACACTCTAGG - Intergenic
905901670 1:41585515-41585537 CCCCGCTCCCATGTCAGTGTTGG + Intronic
906519861 1:46460589-46460611 CCCTGCTCTCAAGTTACCCTGGG - Intergenic
907301230 1:53487519-53487541 CTCCACTGCCAGGTCACTCTTGG - Intergenic
909047765 1:70730704-70730726 CCCTGCTCCCTGGTCACACTGGG - Intergenic
911090218 1:94011776-94011798 CCCCTCCCCTAGGTGACTCTGGG + Intronic
919787589 1:201269687-201269709 CCCCTCTCCCAGGTTACGAAAGG - Intergenic
923368649 1:233288375-233288397 CCCCACTCCCAGCTTTCTCAGGG - Intronic
1064486897 10:15802201-15802223 CCCAACTCCCATGTTACTCAAGG + Intronic
1067222644 10:44355200-44355222 CCCTGCAGCCAGGTTACTCCCGG - Intergenic
1068022931 10:51606971-51606993 CCACCCTCCCAGGGTAATCTGGG - Intronic
1070768428 10:79069317-79069339 TCCCGCTCCCCGGGGACTCTCGG + Intronic
1070798826 10:79233092-79233114 CCACACTCCCAGGTTTGTCTGGG + Intronic
1072746162 10:97940646-97940668 CCCCACCCCCAGGCTGCTCTCGG - Intronic
1074896858 10:117784696-117784718 CCCCTCACCCAGGTTACCCGAGG + Intergenic
1075796652 10:125125014-125125036 AACCGCTCCCAAGTTACACTGGG - Intronic
1077145559 11:1042738-1042760 CACCTCTCCCAGCTTACTCTAGG - Intergenic
1081611384 11:44565391-44565413 CCCCGCCCCCAGGTTACACTGGG - Intronic
1083589277 11:63883456-63883478 CCCCTCTCCAAGGGTTCTCTGGG - Intronic
1083792608 11:64995685-64995707 CCCCGCCCCCAAGTCTCTCTGGG + Intronic
1084402930 11:68955749-68955771 CCCCGGTCTCAGGCCACTCTGGG + Intergenic
1084423649 11:69072718-69072740 CCCTGCTCCCAGCCTCCTCTGGG + Intronic
1085303518 11:75472487-75472509 CCCAGCTCCCAGGGTGATCTGGG + Intronic
1090867952 11:130718812-130718834 TCCAGCTCCCAGCTTGCTCTTGG + Intergenic
1091618075 12:2065066-2065088 CCCTGCTCACAGGTGCCTCTGGG + Intronic
1091840248 12:3615429-3615451 CCCCTCTCCCAGGTTCCTCAAGG - Exonic
1101909253 12:108850088-108850110 CCCCTCCCCCAGCTCACTCTTGG - Intronic
1101916005 12:108896644-108896666 CTCAGCTCCAAGGTTTCTCTGGG + Intronic
1102919694 12:116782633-116782655 CCTCCCTCCCAGGTTACCATGGG + Intronic
1106912634 13:34479204-34479226 GCCCCCTCCCAGGTTATGCTGGG + Intergenic
1107903669 13:45043000-45043022 CCCCTCTCCCTGTTTATTCTGGG - Intergenic
1112312152 13:98328313-98328335 CCCAGCTTTAAGGTTACTCTGGG + Intronic
1112334092 13:98499664-98499686 CACTGCTCCCTGCTTACTCTTGG - Intronic
1116916844 14:50532966-50532988 CCCCGCTGCCAGGTTACTTCTGG - Intronic
1119428845 14:74552625-74552647 CCCATCTCCCAGGTTATTGTGGG - Intronic
1119602501 14:75985985-75986007 CCCCGCCCCCAGGCCACTGTGGG + Intronic
1122723000 14:103732494-103732516 CCTCACTGCCAGGCTACTCTTGG + Intronic
1123684523 15:22787296-22787318 GCCCGCTCCTAGGGTACGCTCGG + Intronic
1124996155 15:34724654-34724676 CCCTGATGCCAGGTTATTCTTGG - Intergenic
1125225972 15:37396668-37396690 ACCCACTCCCAGGGTTCTCTGGG - Intergenic
1127703717 15:61527081-61527103 CCCCACTCCCTGTTTCCTCTGGG - Intergenic
1129178865 15:73859055-73859077 GCCCCCTCCCAGGATACTTTTGG - Intergenic
1129946737 15:79545091-79545113 CCCAGCTCCCAGGTTATGCAGGG - Intergenic
1132697924 16:1210186-1210208 CCCCGCCCCCAGGTCCCTCCTGG + Intronic
1133103377 16:3492507-3492529 CCCAGCTCCCAGGTCCCTCTGGG - Intergenic
1135324726 16:21519180-21519202 TTCGGGTCCCAGGTTACTCTGGG - Intergenic
1136175660 16:28514560-28514582 CCCAGCTCCCAGGCTAATATGGG + Intergenic
1136336213 16:29612455-29612477 TGCGGGTCCCAGGTTACTCTGGG - Intergenic
1137061018 16:35791878-35791900 TCCCACTCCCATGTGACTCTGGG + Intergenic
1139582583 16:67882200-67882222 CCCCTCTCCCAGGTGTCTCAAGG + Exonic
1141174367 16:81709529-81709551 CCCCGCTGCCTGGTTTCTCCGGG + Intronic
1142899508 17:3003523-3003545 CGCGGCTCCCAGGCCACTCTTGG + Intronic
1147186444 17:38715843-38715865 CCCTGCTCCCAGCTTCCTCCCGG - Intronic
1148469577 17:47884896-47884918 CCCAGCTGCCAGTTTTCTCTAGG + Intergenic
1148677293 17:49452727-49452749 CCCTGCTCCCAGCATCCTCTTGG + Intronic
1148772851 17:50076919-50076941 CCCCGCCCCCAGGGCACTCCCGG - Intronic
1149376302 17:56047540-56047562 CCCAGCTCCCAAGTTGCTATGGG + Intergenic
1149656370 17:58311537-58311559 CCCCACTCCCAGGGTACAGTGGG + Intronic
1150219867 17:63489970-63489992 CCCAGCTCCCAGGCCACGCTGGG - Intronic
1150562254 17:66303423-66303445 CGCCGCTCCCCCGTTACTCCGGG - Intronic
1151022354 17:70631983-70632005 CCCCTTTCCCAGGTTCCCCTGGG - Intergenic
1151150764 17:72084074-72084096 CCCTGCTTCCAGGTTGCTCGAGG - Intergenic
1153581880 18:6582136-6582158 CCCCTTTCCCAGGTTACATTTGG - Intronic
1157113660 18:44843632-44843654 CACCCCTCCCAGGTGGCTCTTGG + Intronic
1157396544 18:47346250-47346272 CCCTGCTGCCAAGTTTCTCTGGG - Intergenic
1157709520 18:49840614-49840636 GCCCGCTCACAGGTTCCTGTAGG - Intronic
1160797623 19:953167-953189 CCCCACTCCCAGGTGGCCCTGGG + Intronic
1161126418 19:2560496-2560518 CCCTGCTCCCAGGGGACCCTGGG + Intronic
1161296982 19:3525098-3525120 CCACACTCCCAGGTGGCTCTGGG + Intronic
1165078000 19:33291406-33291428 CCCCTCTCCCCGGTTGCTCTGGG + Intergenic
1167293504 19:48636759-48636781 CCCCGCACGCAGGTTTCTATGGG + Intronic
1167998959 19:53429616-53429638 CCCTGCCCCCAGGTGATTCTAGG + Intronic
925888931 2:8417716-8417738 CCCAGCTCTCTGGTTAGTCTAGG - Intergenic
927495191 2:23547184-23547206 CCCCGCTCCCTGGCCACTCTGGG + Intronic
927956627 2:27211851-27211873 CGCCGCTCCCCGGTGCCTCTCGG + Intronic
932564388 2:72896437-72896459 TCCCGCACCCAGGTCCCTCTGGG + Intergenic
1172186890 20:33036544-33036566 CCCAGCTCCCAGGTGGCCCTAGG - Intronic
1172773945 20:37396610-37396632 CCTCCCTTCCAGCTTACTCTGGG - Intronic
1173667883 20:44775572-44775594 CCCCGCTGTGGGGTTACTCTGGG - Intronic
1173933548 20:46841695-46841717 CCCTGCTCCCAGGTTATACTTGG + Intergenic
1175306070 20:57976424-57976446 CCCAGCTCCCAGGTTGGCCTAGG + Intergenic
1175725822 20:61317708-61317730 CCCTGCTCCCAGGGGACACTGGG - Intronic
1176019884 20:62957185-62957207 CCCAGCTCCCATCTTCCTCTGGG - Intronic
1176119308 20:63446827-63446849 CCCTGCCCCCAGGTTCCTCCTGG - Exonic
1176381971 21:6118178-6118200 ACCCGATCCCAGGTTATTCTTGG - Intronic
1179741501 21:43420061-43420083 ACCCGATCCCAGGTTATTCTTGG + Intronic
1181439612 22:22928995-22929017 ACCCCCTCCCAGGCTATTCTGGG - Intergenic
1183464415 22:37972562-37972584 CCCAGCACCCAGGTTGCTGTCGG - Exonic
1184877072 22:47282727-47282749 CCCAGCCTCCAGCTTACTCTGGG + Intergenic
950658577 3:14452595-14452617 CCCCGCTCCCAGGTTACTCTTGG + Intronic
953058478 3:39406942-39406964 ACCCGCTCCCGGGGCACTCTGGG - Intronic
953461666 3:43086123-43086145 CCAAGCTCCCAGGTGATTCTGGG + Intronic
964804747 3:160596380-160596402 CCCCTCTCCCACTTTAGTCTGGG - Intergenic
967387652 3:188927205-188927227 CCCAGCTCCCAGGCTACACCTGG - Intergenic
969098709 4:4752963-4752985 CCCTGCCCCCAGTTAACTCTGGG + Intergenic
972334980 4:38099722-38099744 CTCCACTGCCAGGTTTCTCTTGG + Intronic
981061312 4:140427793-140427815 CCCCGCTCCCGGGTTAGCCCAGG + Exonic
985873727 5:2579109-2579131 CCTCTCTCCCAGGGGACTCTCGG + Intergenic
985968771 5:3358283-3358305 CCCAGCTCACAGGTAACTCCGGG + Intergenic
986176841 5:5359813-5359835 CTTTGCTCCCAGGTTCCTCTGGG + Intergenic
986543419 5:8870620-8870642 ACCAGGTCTCAGGTTACTCTGGG + Intergenic
988775426 5:34474075-34474097 CACCTCACCCAGGTTCCTCTAGG - Intergenic
991453831 5:66781272-66781294 CCCTGCTCCCAGGTTAGTGGTGG + Intronic
998380124 5:141718343-141718365 CACCTTTCCCAGGCTACTCTTGG + Intergenic
1000991094 5:167912826-167912848 CCCCACTCTCTAGTTACTCTTGG - Intronic
1001525366 5:172424996-172425018 CCCCGTTCCTAGGTAACTCATGG + Intronic
1005004541 6:21274558-21274580 CACCGCTCCCAGCCTACTTTTGG + Intergenic
1008160048 6:48066058-48066080 TCCAGCTTGCAGGTTACTCTGGG + Intronic
1010275250 6:73961626-73961648 CCCAGCTGCCAGGTGAATCTAGG + Intergenic
1011472009 6:87717455-87717477 CCCAGCTCCCAGGTGGCTCCTGG - Intergenic
1011762740 6:90586604-90586626 CCCCACTCCCACGTTACTGAGGG + Intronic
1026439335 7:70430238-70430260 CCCCTCTCCCACGTTGCCCTTGG - Intronic
1026481805 7:70785878-70785900 CCCTGCTCCCAGGAAGCTCTGGG + Intronic
1033598085 7:142870680-142870702 CACCACTCCCTGCTTACTCTAGG - Exonic
1038493792 8:27987823-27987845 CCCCACTCCCAGCTTCCTCAGGG + Intronic
1038797952 8:30726369-30726391 CCCAAATCCCAGGTTCCTCTTGG + Intronic
1045005579 8:97914162-97914184 CCAAGCTCCCAGCCTACTCTTGG - Intronic
1046717122 8:117579998-117580020 CCCAACCCCCAGGTAACTCTGGG - Intergenic
1047422465 8:124718456-124718478 CCCCGCTCCCTGTTTCCTATTGG + Intronic
1048886356 8:138913055-138913077 CCCCTCTCCCAGCCTTCTCTAGG - Intronic
1060588301 9:124800399-124800421 CCCTCCTCCCAGGTGACTATGGG - Intronic
1061401259 9:130369671-130369693 TCCCGCTCCCATGTCACTGTCGG - Intronic
1188404259 X:29787137-29787159 CTCCTCTCCCAGGTTTCTGTGGG - Intronic
1192463289 X:71336329-71336351 CCCTGCTCCCAGGATGCTCTGGG - Intergenic
1196919742 X:120573719-120573741 CCCTGATCCCAGTTTTCTCTGGG + Intronic
1199717665 X:150517760-150517782 CCTCCCTCCCAGTTCACTCTGGG - Intergenic