ID: 950660964

View in Genome Browser
Species Human (GRCh38)
Location 3:14466799-14466821
Sequence CACACCCGCCACAGGCCCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 329
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 310}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950660964_950660968 -3 Left 950660964 3:14466799-14466821 CCACCGGGCCTGTGGCGGGTGTG 0: 1
1: 0
2: 0
3: 18
4: 310
Right 950660968 3:14466819-14466841 GTGCCTGTCCACGGTGCTGATGG 0: 1
1: 0
2: 1
3: 16
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950660964 Original CRISPR CACACCCGCCACAGGCCCGG TGG (reversed) Intronic
900163526 1:1235700-1235722 CAACCAGGCCACAGGCCCGGCGG - Intergenic
900364559 1:2305799-2305821 CACAGCTGCCACAGGCCTGGCGG + Intronic
900371736 1:2335306-2335328 CATACCCGCCCCACCCCCGGCGG + Intronic
901628750 1:10638337-10638359 CAGACCCGACCCAGGCCTGGGGG + Exonic
902046145 1:13526075-13526097 CACACCCGGGCCAGGCGCGGTGG - Intergenic
902503583 1:16925839-16925861 CACACCCGCTGCAGACCCTGGGG - Intronic
902570543 1:17344511-17344533 CCCTCCCGTCACAGGCCCAGAGG + Intronic
902744247 1:18462870-18462892 CACACCCCCAACAGGCCCCAGGG - Intergenic
904004216 1:27355295-27355317 CACACCAGCCCCAGGACCTGGGG - Exonic
905808514 1:40894404-40894426 CCCTCCCACCACAGGCCCAGAGG - Intergenic
906778374 1:48550306-48550328 CATTCCCTCCACAGGCCCCGGGG + Intronic
906811709 1:48833885-48833907 CACTTCCACCACAGGCCCAGGGG + Intronic
908720432 1:67119885-67119907 CACTCCCACAACAGGCCCAGAGG + Intronic
909794768 1:79719459-79719481 CCTTCCCACCACAGGCCCGGAGG - Intergenic
909834068 1:80231398-80231420 CCCTCCCGTCACAGGCCTGGAGG - Intergenic
909918268 1:81348002-81348024 CACTCCCACCACAGGCCCAGAGG + Intronic
912043022 1:105416469-105416491 CACTCCCATCACAGGCCCAGAGG + Intergenic
915858574 1:159418288-159418310 CCCTCCCACCACAGGCCAGGAGG + Intergenic
917228933 1:172814659-172814681 CCCTCCCATCACAGGCCCGGAGG - Intergenic
918049246 1:180959817-180959839 CCCTCCCATCACAGGCCCGGAGG - Intergenic
918622169 1:186618236-186618258 CACACCCACCACAGGTCCAGTGG - Intergenic
921880463 1:220249661-220249683 CTCTCCCATCACAGGCCCGGAGG + Intronic
922230948 1:223685625-223685647 CACACACCCCACAGTCCTGGTGG + Intergenic
1066058551 10:31703073-31703095 CCCTCCCATCACAGGCCCGGAGG + Intergenic
1066480004 10:35786398-35786420 CACTCCCATCACAGGCCCTGAGG - Intergenic
1067373782 10:45709027-45709049 CACACCCTGCACAGACCCTGAGG - Intergenic
1067379901 10:45763205-45763227 CACACCCTGCACAGACCCTGAGG + Intronic
1067881612 10:50050794-50050816 CACACCCTGCACAGACCCTGAGG - Intergenic
1067887600 10:50103859-50103881 CACACCCTGCACAGACCCTGAGG + Intronic
1069774713 10:70919621-70919643 CACACCTCCCCCAGGCCCAGAGG - Intergenic
1070862003 10:79677246-79677268 CCCACCCCCGACAGGCCCTGGGG + Intergenic
1072555332 10:96510352-96510374 CTCACCAGCCCCAGGCCAGGAGG + Intronic
1072808161 10:98438843-98438865 CCCTCTCGCCACAGGCCTGGAGG + Intronic
1073005518 10:100321170-100321192 AACACCCGACACAGGCACAGTGG + Intronic
1076089387 10:127668527-127668549 CCCACCCGTGACAGGCCCCGGGG + Intergenic
1076216292 10:128696209-128696231 CAGCCCAGCCACAGGCACGGTGG + Intergenic
1076347312 10:129788345-129788367 CATCCCCTCCACAGGCCCTGGGG + Intergenic
1076634190 10:131872143-131872165 CAAACCCGGAGCAGGCCCGGGGG + Intergenic
1076904247 10:133354459-133354481 GACACCAGCCCCAGGCCCTGGGG + Intergenic
1077225026 11:1435908-1435930 CCCACCCGCTCCAGGGCCGGAGG - Intronic
1077274087 11:1695334-1695356 CATACAAGCCACAGGCCCCGTGG + Intergenic
1077337645 11:2012568-2012590 CAGTCACGCCACAGGCCAGGTGG - Intergenic
1078834852 11:15017491-15017513 CCCTCCCATCACAGGCCCGGAGG + Intronic
1079031129 11:16987260-16987282 CACACCCCCCACTGACCTGGTGG + Intronic
1079586225 11:22129000-22129022 CCCTCCCATCACAGGCCCGGAGG - Intergenic
1080746004 11:35109374-35109396 CCCACCCATCACAGGCCTGGAGG + Intergenic
1080909553 11:36581732-36581754 CCCTCCCGTCACAGGCCCAGAGG - Intronic
1081142091 11:39513995-39514017 CACTACCACCACAGGCCCGGGGG + Intergenic
1082799127 11:57401381-57401403 CACACCTGCTACAAGCCAGGTGG + Intronic
1083540054 11:63506246-63506268 CACACCAGCCCCACTCCCGGTGG - Intronic
1083656205 11:64230870-64230892 CACAGCCGGCACAGGCGCAGGGG - Exonic
1085258386 11:75190289-75190311 CTCACCAGCCACAGGGCCTGAGG - Intronic
1085729268 11:78982566-78982588 CACACCCCCAATAGGCCCTGTGG + Intronic
1087474370 11:98618261-98618283 CCCTCCCACCACAGGCCCAGAGG - Intergenic
1087807340 11:102569104-102569126 CCCTCCCATCACAGGCCCGGAGG - Intergenic
1089730224 11:120514584-120514606 CACCCCCACCCCAGGCCTGGTGG + Intronic
1091049235 11:132352614-132352636 CACACTGGACACAGGCCTGGGGG - Intergenic
1091147442 11:133291876-133291898 CAAGCCGGCCACAGGCCCTGGGG - Intronic
1091300567 11:134504649-134504671 CACAACGGCCCCAGGCCTGGAGG + Intergenic
1202820629 11_KI270721v1_random:67750-67772 CAGTCACGCCACAGGCCAGGTGG - Intergenic
1092618230 12:10234772-10234794 CACTCCCATCACAGGCCTGGAGG - Intergenic
1093967310 12:25340952-25340974 CTCTCCCATCACAGGCCCGGAGG - Intergenic
1095382763 12:41615366-41615388 CCCTCCCACCACAGGCCCTGAGG + Intergenic
1095556614 12:43513896-43513918 CTCACCCGCAACAGGCCTGGGGG - Intronic
1096102491 12:48978266-48978288 CACCCCCGCCCCCTGCCCGGTGG - Intergenic
1099088584 12:78278114-78278136 CCCTCCCGTCACAGGCCCAGAGG + Intergenic
1099700445 12:86075857-86075879 CCCTCCCACCACAGGCCCAGAGG - Intronic
1101592718 12:106138621-106138643 GTCCCCCGCCACAGGCGCGGCGG + Exonic
1103223551 12:119267172-119267194 CCCTCCCGTCACAGGCCTGGAGG + Intergenic
1103724673 12:122991752-122991774 CACACTCGGCACAGCCCGGGCGG + Intronic
1103797066 12:123510343-123510365 CACACCCCCCACATGCCCAAGGG - Intronic
1104898377 12:132175298-132175320 CACCCCCACCACAGGCCTTGTGG + Intergenic
1107555747 13:41515761-41515783 CACACCTGCGACAGGCCCAGGGG - Intergenic
1108643559 13:52405868-52405890 CACACCCGCCTCGGCCCCAGGGG - Intronic
1110022270 13:70490478-70490500 CTCTCCCACCACAGGCCGGGAGG + Intergenic
1110793684 13:79612818-79612840 CCCTCCCATCACAGGCCCGGAGG - Intergenic
1111527658 13:89492692-89492714 CACTCCCATCACAGGCCCAGAGG - Intergenic
1112259362 13:97864045-97864067 CACTCCCATCACAGGCCCAGAGG - Intergenic
1112451042 13:99509691-99509713 CCCTCCCACCACAGGCCCAGAGG - Intronic
1112789578 13:102988111-102988133 CCCTCCCGTCACAGGCCTGGAGG - Intergenic
1113588726 13:111483382-111483404 CACAAAGGCCACAGGCCAGGTGG - Intergenic
1114147493 14:19994129-19994151 CTCTCCCACCACAGGCCCAGAGG - Intergenic
1114402099 14:22419554-22419576 CACAGCCTACACAGGGCCGGAGG + Intergenic
1114948360 14:27715715-27715737 CACTCCCATCACAGGCCCTGAGG + Intergenic
1115112412 14:29839932-29839954 CCCTCCCATCACAGGCCCGGAGG - Intronic
1115990073 14:39141868-39141890 CCCTCCCATCACAGGCCCGGAGG - Intergenic
1117854233 14:60010481-60010503 CACTCCCATCACAGGCCTGGAGG - Intronic
1118669058 14:68102187-68102209 CCCACCCATCACAGGCCCAGAGG - Intronic
1120067168 14:80056239-80056261 CACACACACCCCAGGCCTGGGGG - Intergenic
1120394003 14:83944535-83944557 CCCTCCCACCACAGGCCCAGAGG - Intergenic
1120956693 14:90089675-90089697 CCCTCCCATCACAGGCCCGGAGG + Intronic
1122030813 14:98910351-98910373 CAGACCTGCCACTGGCCCGATGG - Intergenic
1122049053 14:99042816-99042838 CGCTCCCGCCACAGGCCCGAGGG + Intergenic
1122858347 14:104570902-104570924 CCCTCTCCCCACAGGCCCGGAGG + Intronic
1124003807 15:25780421-25780443 CACTCCCGGCACAGACCTGGCGG + Intronic
1124893104 15:33750877-33750899 CACAACCCCCACAGGCCCTGGGG + Intronic
1125483685 15:40097903-40097925 CACAGCAGCCACAGGCCATGGGG + Intronic
1125727807 15:41877002-41877024 CTCACCCGCCACTGCCCCAGGGG + Intronic
1125881336 15:43198738-43198760 CCCTCCCATCACAGGCCCGGAGG + Intronic
1125893215 15:43281320-43281342 CACCCCATCCACAGGCCCAGGGG + Intronic
1126348271 15:47718466-47718488 CATCCCCGGCCCAGGCCCGGAGG + Intronic
1126815004 15:52446150-52446172 CCCTCCCACCACAGGCCCAGAGG + Intronic
1127145049 15:56014906-56014928 CCCTCCCATCACAGGCCCGGAGG - Intergenic
1128786849 15:70403971-70403993 CACACCTCCCCCAGGCCAGGTGG + Intergenic
1132567772 16:631145-631167 GGCACCGACCACAGGCCCGGAGG + Exonic
1132604507 16:788177-788199 CGCGCCCCGCACAGGCCCGGTGG + Intronic
1132809517 16:1790823-1790845 CACAGGCGCTCCAGGCCCGGGGG + Exonic
1132954405 16:2583856-2583878 CACCCCCGGCACTGGCCCCGGGG + Intronic
1132959940 16:2616307-2616329 CACCCCCGGCACTGGCCCCGGGG - Intergenic
1133712150 16:8411682-8411704 CCCACCCACCACAGGCTCTGTGG + Intergenic
1133975055 16:10594750-10594772 CACACCACCCACATGCCAGGCGG + Intergenic
1135879593 16:26241043-26241065 CACTGCCACCACAGGCCCTGGGG - Intergenic
1136146081 16:28317456-28317478 CACACCGGCACCAGGCCCAGGGG - Exonic
1136247983 16:28986031-28986053 CACACCCTGGACAGGCCTGGGGG - Intronic
1137266330 16:46871766-46871788 CCCTCCCATCACAGGCCCGGAGG - Intergenic
1138552965 16:57757331-57757353 CACACCCCCTCCAAGCCCGGGGG + Intergenic
1140623334 16:76763120-76763142 CCCACCCACCACAGTCCCAGAGG + Intergenic
1140881277 16:79200172-79200194 GACATCCGCCAGAGGCCTGGTGG + Intronic
1142470947 17:162973-162995 CACACCCGGCCCAGGCTGGGAGG + Intronic
1143032812 17:3977150-3977172 CACACCCAGCGCAGGCCCAGTGG + Intergenic
1143452525 17:7044049-7044071 CACACAACCCCCAGGCCCGGGGG + Intergenic
1144299440 17:13909967-13909989 CCCTCCCGTCACAGGCCCAGAGG + Intergenic
1144639120 17:16927893-16927915 GACACCTGCCACAGGCCCCCGGG + Intergenic
1148469432 17:47884226-47884248 CTCACCACCCACAGGCCTGGGGG - Intergenic
1148774886 17:50089728-50089750 CCCACCAGCCAGCGGCCCGGGGG - Exonic
1149535723 17:57431909-57431931 CACCGCCGCCAAATGCCCGGTGG - Intronic
1149587416 17:57801482-57801504 CCCACCCATCACAGGCCCTGAGG + Intergenic
1151930789 17:77230304-77230326 CTCACCTGGCACAGGCCTGGTGG - Intergenic
1152245927 17:79184524-79184546 CACACTCACCAGAGGCCCCGTGG + Intronic
1153348400 18:4052556-4052578 CCCTCCCGTCACAGGCCTGGAGG - Intronic
1153421962 18:4916852-4916874 CCCTCCCATCACAGGCCCGGAGG - Intergenic
1156052399 18:32952582-32952604 CCCTCCCGTCACAGGCCTGGAGG - Intronic
1157562011 18:48654959-48654981 CCCACCCCACACAGGCCCTGGGG - Intronic
1159962463 18:74566210-74566232 CCCACCCATCACAGGCCTGGAGG - Intronic
1160605776 18:80048635-80048657 CACATCCGGCACAGGCGTGGAGG - Intronic
1161767056 19:6213833-6213855 CACACCCTCCCCAGCCCCGAAGG + Intronic
1162309864 19:9899846-9899868 CACACCCGCCCCACCCCCGCCGG + Intronic
1162726311 19:12691478-12691500 CACACCTGCCACAGCCCATGGGG + Intronic
1163315341 19:16537222-16537244 AGCACCTGCGACAGGCCCGGGGG - Intronic
1164596195 19:29531857-29531879 CAGAGCCGCCACATGCCCTGGGG - Intronic
1165831013 19:38730329-38730351 CACGCCCGACGCAGACCCGGAGG - Exonic
1166919585 19:46220234-46220256 CACACCCACCACAGGCAAGCCGG + Intergenic
1167552237 19:50169197-50169219 CACACCCTCCCGAGGCCCAGGGG + Intergenic
925177875 2:1797870-1797892 CCCATCCGGCACAGGCGCGGCGG + Intronic
925177912 2:1797989-1798011 CCCATCCGGCACAGGCGCGGCGG + Intronic
925177922 2:1798018-1798040 CCCATCCGGCACAGGCGCGGCGG + Intronic
925456233 2:4018769-4018791 CCCTCCCACCACAGGCCCAGAGG - Intergenic
925526668 2:4810567-4810589 CACACCAGCCCCAGGCGGGGTGG - Intergenic
926696380 2:15772264-15772286 CCCACCAGCCACTGGCTCGGTGG - Intergenic
927396145 2:22654294-22654316 CCCACCCATCACAGGCCCTGAGG + Intergenic
927641036 2:24845778-24845800 CCCTCCCACCACAGGCCCTGAGG + Intronic
930972158 2:57408867-57408889 CACCACCACCACAGGCCCAGGGG - Intergenic
931036626 2:58251478-58251500 CACGCCAGCCCCAGTCCCGGCGG + Intergenic
932343637 2:70982083-70982105 CTCACCGGGCACAGGCACGGTGG - Exonic
934517836 2:94999787-94999809 CAGACCCGGCCCAGGCCCTGCGG - Intergenic
936014557 2:108947765-108947787 CTCTCCCACCACAGACCCGGAGG - Intronic
937073472 2:119083583-119083605 CACACTCGGCACAGGCCCTTGGG - Intergenic
937721532 2:125102345-125102367 CACCCCCGCAACAGGCCCCGGGG - Intergenic
938849969 2:135250499-135250521 CCCTCCCGTCACAGGCCAGGAGG + Intronic
941225943 2:162848459-162848481 CCCTCCCACTACAGGCCCGGAGG - Intergenic
941424104 2:165320821-165320843 CCCTCCCGTCACAGGCTCGGAGG - Intronic
941672532 2:168310379-168310401 CACTGCCACCACAGGCCCAGAGG + Intergenic
946515437 2:220405819-220405841 CCCTCCCACCACAGGCCCAGAGG - Intergenic
946766585 2:223046334-223046356 CACACTCGCCCCAGGCCTTGGGG + Intergenic
948837655 2:240633860-240633882 CCCACCCATCACAGGCCTGGAGG + Intergenic
948980470 2:241491918-241491940 CACACCAGCTCCAGGCCCTGAGG - Intronic
1171249464 20:23637459-23637481 CACGCCCGCCAAGGGCTCGGGGG + Intronic
1173221671 20:41137192-41137214 CCCACAGGCCGCAGGCCCGGCGG - Intronic
1177139652 21:17344517-17344539 CTCTCCCACCACAGGCCTGGAGG + Intergenic
1179427844 21:41295891-41295913 CACACCCACCGCAGGGCTGGTGG - Intergenic
1179905718 21:44421975-44421997 CACACCAGCCAGCGGCCCAGCGG - Intronic
1180140956 21:45893134-45893156 CACAACTGCCATAGGCCCTGAGG - Intronic
1180215257 21:46319346-46319368 CACACCCTCCACAGATCTGGAGG - Intronic
1183878445 22:40804770-40804792 CACAATCGACACAGACCCGGAGG - Intronic
1184070381 22:42143182-42143204 CAGACCCGCCAGAAGCCCGGTGG - Intergenic
1184661540 22:45967692-45967714 CCCACCCACCACATCCCCGGAGG - Intronic
1185095980 22:48806328-48806350 CACACCCACCCCAGCCCCAGGGG - Intronic
1185409241 22:50673911-50673933 CCCCCCCGCCCCAGGCCTGGGGG - Intergenic
950660964 3:14466799-14466821 CACACCCGCCACAGGCCCGGTGG - Intronic
951180721 3:19655141-19655163 CACTCCCATCACAGGCCCAGAGG - Intergenic
952139121 3:30458902-30458924 CACTCCCATCACAGGCCCAGAGG + Intergenic
952202705 3:31147757-31147779 CCCTCCCGTCACAGGCCTGGAGG - Intergenic
952220006 3:31315636-31315658 CTCTCCCACCACAGGCCCAGAGG + Intergenic
952624927 3:35392413-35392435 CCCTCCCATCACAGGCCCGGAGG - Intergenic
953006022 3:38980039-38980061 CACACCAGCACCAGGCCCAGGGG + Intergenic
953551796 3:43908849-43908871 CACACCAGCCACAGGTGTGGGGG + Intergenic
954327374 3:49870872-49870894 CACACCCCTCACAAGCCCTGAGG + Intergenic
954623291 3:52007797-52007819 GACACCTGCCACAGGCCCACAGG + Intergenic
955391665 3:58526566-58526588 CATGTCCGCCACAGGCCCTGCGG + Exonic
955869109 3:63417881-63417903 CCCTCCCATCACAGGCCCGGAGG - Intronic
957148770 3:76457982-76458004 CCCTCCCATCACAGGCCCGGAGG - Intronic
961369140 3:126418982-126419004 CACACCACCCACAGGCCCCAGGG - Intronic
961451393 3:127003881-127003903 CAGGCCAGCCACAGGCCCTGTGG - Intronic
961823713 3:129588050-129588072 CACACCCAGCACAGGCCCTGGGG - Intronic
961865611 3:129951464-129951486 CACAGCCTCCACAGGCCCCATGG + Intergenic
965865922 3:173203674-173203696 CACTCCCATCACAGGCCCAGAGG - Intergenic
966722692 3:183080053-183080075 CCCTCCCATCACAGGCCCGGAGG - Intronic
967047964 3:185755123-185755145 CCCTCCCACCACAGGCCCAGAGG + Intronic
967406157 3:189118529-189118551 CCCACCTGTCACAGGCCTGGAGG + Intronic
968876072 4:3268658-3268680 CAGACCACCCACAGGCCGGGAGG + Intronic
969759633 4:9172889-9172911 CTCACCTGCCACAGGGCCTGTGG - Intronic
970462013 4:16284188-16284210 CCCTCCCATCACAGGCCCGGAGG + Intergenic
972321589 4:37977437-37977459 CACTCCCGCCGCCGGCCCGTGGG - Intronic
972582391 4:40406517-40406539 CACTCCCATCACAGGCCCAGAGG + Intergenic
974215499 4:58841758-58841780 CCCTCCCATCACAGGCCCGGAGG + Intergenic
974679911 4:65147168-65147190 CCCACCCATCACAGGCCTGGAGG - Intergenic
977418338 4:96764070-96764092 CACACCATCCATAGGCCTGGGGG - Intergenic
978234984 4:106447028-106447050 CCCTCCCACCACAGGCCTGGAGG - Intergenic
980335511 4:131468743-131468765 CCCTCCCATCACAGGCCCGGAGG + Intergenic
981131327 4:141161613-141161635 CCCTCCCACCACAGGCCCAGAGG + Intronic
981176908 4:141692272-141692294 CACACCCATTACAGGCCTGGAGG - Intronic
981281728 4:142966454-142966476 CCCTCCCATCACAGGCCCGGAGG - Intergenic
981355461 4:143784732-143784754 CACTCCCATCACAGGCCCAGAGG + Intergenic
981378243 4:144040297-144040319 CACTCCCATCACAGGCCTGGAGG - Intergenic
983006350 4:162490198-162490220 CACTCCCATCACAGGCCTGGAGG + Intergenic
983393879 4:167168808-167168830 CCCTCCCGCCACAGGCCCAGAGG + Intronic
984900401 4:184581053-184581075 CCCTCCCATCACAGGCCCGGAGG - Intergenic
985724347 5:1507977-1507999 CACACGCACCAGAGGCCCGAGGG + Intronic
985757711 5:1729095-1729117 CAGACCCGCCGGAGGCCGGGAGG + Intergenic
985770266 5:1805493-1805515 CAGGCCCGTCACAGGCCCAGGGG - Intronic
986530085 5:8726890-8726912 CTCTCTAGCCACAGGCCCGGAGG - Intergenic
986852405 5:11829351-11829373 CACTCCCATCACAGGCCAGGAGG + Intronic
987000023 5:13651220-13651242 CCCACCCATCACAGGCCTGGAGG + Intergenic
988808867 5:34765812-34765834 CTCTCCCACCACAGGCCAGGAGG + Intronic
989047044 5:37283458-37283480 CCCACCCATCACAGGCCCAGAGG - Intergenic
989520312 5:42393125-42393147 CACACCCATCACAGGCCCAGAGG - Intergenic
990337178 5:54786278-54786300 CCCACCTGCCATAGGCCTGGAGG - Intergenic
993703844 5:91148305-91148327 CCCTCCCATCACAGGCCCGGAGG + Intronic
993945863 5:94116500-94116522 CCCTCCCACCACAGGCCCAGAGG + Intergenic
994185021 5:96807541-96807563 CGCACCGGCCACGCGCCCGGAGG + Intronic
995244127 5:109918235-109918257 CCCTCCCGTCACAGGCCCAGAGG + Intergenic
996398725 5:123036864-123036886 CGCACCCGCCTAAGGCGCGGCGG - Intergenic
997220277 5:132156806-132156828 GGCACCCGCCAGAGGCCAGGCGG + Intergenic
1000226476 5:159266641-159266663 CCCTCCCAGCACAGGCCCGGAGG + Intronic
1000728545 5:164802125-164802147 CCCTCCCATCACAGGCCCGGGGG - Intergenic
1001635321 5:173206005-173206027 CTCACCTGCCACAGCCCCAGTGG + Intergenic
1001944472 5:175767171-175767193 CCCTCCCATCACAGGCCCGGAGG - Intergenic
1002759602 6:191463-191485 CACACCCCCCTCATGCCCTGAGG + Intergenic
1003112963 6:3264357-3264379 CACACTGGCCACAGGCACTGGGG - Intronic
1004960397 6:20782127-20782149 CACAACCGCCACTGTCCTGGAGG - Intronic
1007363768 6:41375817-41375839 CACCCCCTCCCCAGGCCTGGAGG - Intergenic
1007739834 6:44003606-44003628 CATCCCCGCCACAGACACGGAGG + Exonic
1009547023 6:65033417-65033439 CACTCCCATCACAGGCCAGGAGG + Intronic
1010145945 6:72669566-72669588 CACTCCCACCACAGGCCCAAGGG - Intronic
1011629110 6:89307682-89307704 CACAACAGTCACAGGCCCTGAGG - Intronic
1012762243 6:103317290-103317312 CCCTCCCACCACAGGCCTGGAGG + Intergenic
1013088415 6:106876143-106876165 CTCTCCCGTCACAGGCCCAGAGG - Intergenic
1013227474 6:108130495-108130517 CACTCCCACCACAAGCCCAGAGG - Intronic
1013591116 6:111620316-111620338 CACACCCTCCCCAGGCTCAGAGG + Intergenic
1014477247 6:121888750-121888772 CACGCCCGCCCCATGCCCTGTGG + Intergenic
1016229840 6:141789288-141789310 CACCACCACCACAGGCCCGTGGG - Intergenic
1016301465 6:142636345-142636367 CACTCCTGCCACAGGCCCAAGGG - Intergenic
1017686918 6:156922922-156922944 CACACGAGCCACAGACCTGGAGG - Intronic
1018378917 6:163240183-163240205 CACTCACCCCACAGGCCCGGCGG - Intronic
1018527430 6:164728697-164728719 CACTCCCATCACAGGCCCAGGGG + Intergenic
1018604813 6:165585633-165585655 CACACCCTCCAGAGGCTCGAAGG - Intronic
1018873718 6:167802528-167802550 CCCACCCTCCATAGGCCCAGAGG - Intergenic
1019554269 7:1620858-1620880 CACACCTGCTCCATGCCCGGCGG - Intergenic
1019650054 7:2152041-2152063 CACACCCACCTCAGGCAAGGAGG - Intronic
1022121702 7:27314656-27314678 CACACCCTCCACTGCCCTGGAGG + Intergenic
1022869683 7:34463167-34463189 CCCACCCCCCACAGGCCCCAGGG - Intergenic
1023188593 7:37555707-37555729 CCCACCCATCACAGGCCTGGAGG - Intergenic
1023880192 7:44313800-44313822 CACATCAGGCACAGGCCCAGAGG + Intronic
1024084023 7:45878696-45878718 CACTCCCAACACAGGCCCAGAGG - Intergenic
1024520969 7:50304123-50304145 CGCACCCGCCGCCGCCCCGGCGG + Intronic
1027519129 7:79181551-79181573 CCCTCCCATCACAGGCCCGGAGG - Intronic
1028957735 7:96712961-96712983 CACACCCATCACAGACCCAGAGG + Intergenic
1030108536 7:106007218-106007240 CACTCCCATCACAGGCCCAGAGG - Intronic
1031255003 7:119435786-119435808 CCCTCCCATCACAGGCCCGGAGG - Intergenic
1031769814 7:125829374-125829396 CCCTCCCACCACAGGCCCAGAGG - Intergenic
1034751837 7:153576259-153576281 CCCTCCCACCACAGGCCTGGAGG + Intergenic
1035057590 7:156046330-156046352 CACACGCCCCACAGGGCAGGGGG + Intergenic
1035418620 7:158709230-158709252 CACACCAGCCGGGGGCCCGGAGG + Intergenic
1036263222 8:7256619-7256641 CCCACCTGCCACAGGGCCCGTGG - Intergenic
1036264525 8:7264241-7264263 CCCACCTGCCACAGGGCCCGTGG - Intergenic
1036265824 8:7271863-7271885 CCCACCTGCCACAGGGCCCGTGG - Intergenic
1036267126 8:7279485-7279507 CCCACCTGCCACAGGGCCCGTGG - Intergenic
1036268429 8:7287107-7287129 CCCACCTGCCACAGGGCCCGTGG - Intergenic
1036269733 8:7294729-7294751 CCCACCTGCCACAGGGCCCGTGG - Intergenic
1036298157 8:7552325-7552347 CCCACCTGCCACAGGGCCCGTGG + Intergenic
1036299462 8:7559975-7559997 CCCACCTGCCACAGGGCCCGTGG + Intergenic
1036300767 8:7567623-7567645 CCCACCTGCCACAGGGCCCGTGG + Intergenic
1036302074 8:7575269-7575291 CCCACCTGCCACAGGGCCCGTGG + Intergenic
1036303369 8:7582916-7582938 CCCACCTGCCACAGGGCCCGTGG + Intergenic
1036315267 8:7715158-7715180 CCCACCTGCCACAGGGCCCGTGG - Intergenic
1036316569 8:7722806-7722828 CCCACCTGCCACAGGGCCCGTGG - Intergenic
1036317876 8:7730454-7730476 CCCACCTGCCACAGGGCCCGTGG - Intergenic
1036319185 8:7738102-7738124 CCCACCTGCCACAGGGCCCGTGG - Intergenic
1036320492 8:7745749-7745771 CCCACCTGCCACAGGGCCCGTGG - Intergenic
1036321802 8:7753397-7753419 CCCACCTGCCACAGGGCCCGTGG - Intergenic
1036323111 8:7761045-7761067 CCCACCTGCCACAGGGCCCGTGG - Intergenic
1036324413 8:7768692-7768714 CCCACCTGCCACAGGGCCCGTGG - Intergenic
1036351621 8:8015615-8015637 CCCACCTGCCACAGGGCCCGTGG + Intergenic
1036352930 8:8023261-8023283 CCCACCTGCCACAGGGCCCGTGG + Intergenic
1036354220 8:8030908-8030930 CCCACCTGCCACAGGGCCCGTGG + Intergenic
1036457754 8:8924548-8924570 CCCTCCCATCACAGGCCCGGAGG - Intergenic
1037346694 8:17908683-17908705 AACACCTGCCACAGCCGCGGTGG + Intronic
1037369699 8:18162814-18162836 CAGACCTGCCACAGGCCAGACGG + Intergenic
1042615941 8:70649274-70649296 GACACCAGCATCAGGCCCGGAGG + Intronic
1046928998 8:119824584-119824606 CCCTCCCATCACAGGCCCGGAGG + Intronic
1052080767 9:24203237-24203259 CCCACCCATCACAGTCCCGGAGG + Intergenic
1052351822 9:27465929-27465951 CCCACCCATCACAGGCCCAGAGG - Intronic
1052540875 9:29810484-29810506 CCCTCCCACCACAGGCCAGGTGG + Intergenic
1052625972 9:30978196-30978218 CACTCCCATCACAGGCCCAGAGG + Intergenic
1057749414 9:97779767-97779789 CCCTCCCACCACAGGCCCAGAGG + Intergenic
1058082291 9:100712732-100712754 CCCTCCCACCACAGGCCCAGAGG - Intergenic
1058834499 9:108848967-108848989 CACTCCCATCACAGGCCCAGAGG - Intergenic
1060526620 9:124324618-124324640 CTGGCCCGCCACAGGCCTGGAGG + Intronic
1187463889 X:19512159-19512181 CCCACTCCCCACAGGCCCTGGGG - Intronic
1188062539 X:25618462-25618484 CCCTCTCGTCACAGGCCCGGAGG - Intergenic
1191696540 X:63996419-63996441 CCCTCCCGCCACAGGCCTGGAGG + Intergenic
1191734700 X:64376839-64376861 CCCTCCCATCACAGGCCCGGAGG + Intronic
1192185709 X:68945562-68945584 CACACCAGCCATAGCCCCTGTGG + Intergenic
1192856585 X:75018443-75018465 CCCTCCCATCACAGGCCCGGAGG - Intergenic
1193335605 X:80285159-80285181 TACATCCGCCACAGGCCAGATGG + Intergenic
1193438772 X:81513031-81513053 CACAGCCACCACAGGCCCATAGG - Intergenic
1194348335 X:92793896-92793918 CACCCCCACCACAGGCCATGGGG - Intergenic
1195715950 X:107819060-107819082 CACTCCCATCACAGGCCCAGAGG + Intergenic
1196483577 X:116179627-116179649 CACTCCCATCACAGGCCCGGAGG + Intergenic
1197040377 X:121929657-121929679 CACTCCCATCACAGGCCCAGAGG + Intergenic
1197567208 X:128101892-128101914 CCCACCCATCACAGGCCCGGAGG - Intergenic
1198520945 X:137451622-137451644 TACTCCCACCACAGGCCCGGGGG - Intergenic
1198734570 X:139772023-139772045 CCCTCCCATCACAGGCCCGGAGG + Intronic
1198944182 X:141991521-141991543 CCCTCCCGTCACAGGCCAGGAGG + Intergenic
1199422938 X:147666890-147666912 CACACACGCGCCAGGCACGGTGG + Intergenic
1199972055 X:152868418-152868440 CACACCCGGGCCAGGCGCGGTGG - Intronic
1200246818 X:154530889-154530911 CACTCCCGCCAGAGGCCCAAGGG - Intergenic
1200354500 X:155534235-155534257 CACTCCCACCACAGGCCCAAGGG + Intronic
1200656662 Y:5910524-5910546 CACCCCCACCACAGGCCATGGGG - Intergenic