ID: 950662721

View in Genome Browser
Species Human (GRCh38)
Location 3:14476707-14476729
Sequence CCGAGCCCTGCCAGACACAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 131}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950662721_950662728 30 Left 950662721 3:14476707-14476729 CCAATGTGTCTGGCAGGGCTCGG 0: 1
1: 0
2: 1
3: 17
4: 131
Right 950662728 3:14476760-14476782 ACCCTTATCTTCCACGAGGATGG 0: 1
1: 0
2: 1
3: 4
4: 72
950662721_950662726 26 Left 950662721 3:14476707-14476729 CCAATGTGTCTGGCAGGGCTCGG 0: 1
1: 0
2: 1
3: 17
4: 131
Right 950662726 3:14476756-14476778 TACCACCCTTATCTTCCACGAGG 0: 1
1: 0
2: 1
3: 4
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950662721 Original CRISPR CCGAGCCCTGCCAGACACAT TGG (reversed) Intronic
901182568 1:7351684-7351706 CCGACCCCGGCCAGACAGGTAGG - Intronic
901718643 1:11177084-11177106 TCCAGCCCTGCCAGACCCAGAGG - Intronic
902159654 1:14519795-14519817 CTGGGTCATGCCAGACACATGGG - Intergenic
902717600 1:18283282-18283304 CCCAGCCCTGCCAGAAACCGGGG + Intronic
905268120 1:36768974-36768996 CCGAGCCCCGCCTGGCACACCGG - Intergenic
917604586 1:176613808-176613830 CCGAGCACTGCCTGTCAAATGGG + Intronic
919402703 1:197139304-197139326 CCGCGCCCGGCCAAAAACATGGG - Intronic
920009119 1:202855024-202855046 CCTAGGGCTGCCAGTCACATGGG - Intergenic
923033903 1:230270752-230270774 CTGAGCCTTGGCAGACACACAGG + Intronic
1063117246 10:3080108-3080130 CCGAGTGCTGCCAGACAGGTGGG + Intronic
1064190322 10:13200362-13200384 CCGGTCCCTGCCAGCCACAGAGG + Intronic
1073963885 10:108965862-108965884 CTCAGCCCTGGCAGGCACATTGG - Intergenic
1076402310 10:130192309-130192331 CCCAGCCCTCCCTGACACAGGGG - Intergenic
1076870168 10:133189110-133189132 CCTAGCCCTGCCAGACATCAGGG + Intronic
1077431377 11:2517508-2517530 CTGAGTCCTGCCAGACAGAGAGG - Intronic
1082658537 11:55881094-55881116 CCAAGACCTACCAGCCACATAGG + Intergenic
1083596506 11:63920419-63920441 GCCAGCCCTGCCAGACAGACTGG + Intergenic
1096524723 12:52203683-52203705 CCCAGCTCTGCCAGAGACAGAGG - Intergenic
1099077883 12:78134597-78134619 CCCAGTCCAGCCAGACACATTGG + Intronic
1102766224 12:115435687-115435709 CAGAGCCCTGTCAGACCCAAAGG + Intergenic
1102825249 12:115943460-115943482 CCGAGCCCTCCCTGAGAGATGGG + Intergenic
1103903807 12:124317147-124317169 CCGAGCCCTGCTTTACTCATGGG + Intergenic
1104966121 12:132509494-132509516 CCCAGCCCTGCCGGCCGCATTGG + Intronic
1104995485 12:132651836-132651858 CCGAGTCCTGCCATCCCCATGGG + Intronic
1105748637 13:23400708-23400730 CCGCGCCCGGCCAGTCACTTTGG + Intronic
1106514844 13:30444545-30444567 CCTTGCCCTGCCACACACAGCGG - Intergenic
1106862222 13:33921996-33922018 CCTATCCCTGCCTGACAGATGGG - Intronic
1109132867 13:58610821-58610843 CCGAGACCTGCCAGGCCCAGTGG + Intergenic
1112479855 13:99765269-99765291 TTGAGAACTGCCAGACACATTGG + Intronic
1118283646 14:64451307-64451329 CCAAGCCAGGCCAGGCACATTGG - Intronic
1122157711 14:99760257-99760279 CTCAGCCCTGTCAGCCACATGGG + Intronic
1122969036 14:105145007-105145029 CCGCTCCCTGCCAGCCACAAGGG - Exonic
1122996549 14:105268386-105268408 CCGGGCCTTGCCAGACTCAGTGG + Intronic
1128037646 15:64540737-64540759 CCGCGCCCAGCCAGACACAAAGG - Intronic
1129759484 15:78121217-78121239 CCCAGCCCTCCCAGACACAGGGG + Intronic
1130191397 15:81739607-81739629 CCGAGCCCTAGCTGACACCTGGG - Intergenic
1132233421 15:100201201-100201223 CCGGTCCCTCCCTGACACATGGG - Intronic
1132954081 16:2581848-2581870 CCTAGTCTCGCCAGACACATTGG + Intronic
1132960264 16:2618315-2618337 CCTAGTCTCGCCAGACACATTGG - Intergenic
1133377011 16:5295468-5295490 CCGAGCCCTGGCTGACACTACGG - Intergenic
1135393912 16:22116611-22116633 CCTAGCCCTGCATGCCACATAGG + Intronic
1136077548 16:27827380-27827402 GCAAGCCCTGCCACAAACATAGG + Intronic
1136254525 16:29029350-29029372 CCCAGCCCCGCCACACACTTGGG + Intergenic
1137300368 16:47143449-47143471 GCGAGCCCCGCCAGACAAAGAGG + Intronic
1138451397 16:57095161-57095183 CCCAACCCTGCCAGACACGGTGG + Intronic
1141693279 16:85608219-85608241 CCCAGCCCTGCCCTACGCATCGG - Intergenic
1142282617 16:89156518-89156540 CTGACCCCAGCCAGACACAGGGG + Intergenic
1142995466 17:3757424-3757446 CTGAGTCCTGCCAGACAAATGGG - Intronic
1143832085 17:9660634-9660656 CTGGGCCCTGTCAGTCACATAGG - Intronic
1143892711 17:10114951-10114973 CCCAGCCCTGCCAGCCACAGAGG - Intronic
1144107243 17:11997285-11997307 CCGCGCGCTCCCAGACGCATGGG + Exonic
1144650244 17:17002721-17002743 CTGAGCCCTGCCCGAGACAGTGG - Intergenic
1145006962 17:19343683-19343705 CGGGGACCTGCCAGGCACATAGG - Intronic
1145853814 17:28132823-28132845 CTGAGCTCTGCCAGACACACAGG - Intronic
1145899000 17:28477758-28477780 CCATGCCCAGCCCGACACATAGG - Intronic
1147142704 17:38468332-38468354 CCAAGCCCGGCCAGAAACCTGGG - Intronic
1147390001 17:40103295-40103317 TCCAGCCCTGACAGACACCTGGG - Intergenic
1147423167 17:40332453-40332475 CCCAGCCCAGCCAGGCACATAGG - Intronic
1151951830 17:77358794-77358816 CCCTGCCCTGCCAGACAGGTGGG + Intronic
1152699029 17:81810225-81810247 CCGAGCCCTCCCAGGCCCCTGGG - Intronic
1152914272 17:83024864-83024886 CCAACTCCTGCCAGACACATCGG + Intronic
1153462799 18:5355128-5355150 CTGAGCCCTGCAACACACAGTGG - Intergenic
1154333369 18:13447803-13447825 CTGGGCCGTGCCAGACAGATGGG + Intronic
1157386410 18:47262566-47262588 CCCCGCTCTGCCAGACACACTGG + Intergenic
1160927549 19:1554213-1554235 GGGAGCCATGACAGACACATGGG - Intergenic
1161446993 19:4324020-4324042 CCAAGCCAAGCCAGACACATGGG + Intergenic
1162043067 19:7982014-7982036 CCCAGCCCTGCCAGACAGTGGGG + Intronic
1163053481 19:14702088-14702110 CCGAGACCTCCCTGTCACATGGG + Intronic
1164566357 19:29328814-29328836 CCAAGCCCTGCCAGCCTCACTGG - Intergenic
1164940537 19:32249764-32249786 CAGCTCCCTGCCAGGCACATAGG + Intergenic
1167380578 19:49135853-49135875 CCGACCACTGCCAGCCACATAGG - Exonic
1168723685 19:58569421-58569443 CTGAGCCCAGCCAGGCACAGAGG - Intronic
926246099 2:11123389-11123411 CCTGGCCCTGCCACACACCTGGG + Intergenic
929779801 2:44950095-44950117 CCGAGCCCCGCCCGGCACAGTGG - Intergenic
931395937 2:61888516-61888538 CCGAGCCAACCCAGACACAGCGG - Exonic
937366222 2:121264070-121264092 CCAAGCCCTGCCACCTACATAGG + Intronic
937722913 2:125125088-125125110 CCCAGCCTTGCTAGAGACATAGG - Intergenic
938295336 2:130174798-130174820 CCGAGCACTGCCTGGCACAGAGG - Intronic
938461284 2:131499047-131499069 CCGAGCACTGCCTGGCACAGAGG + Intergenic
938716951 2:134029650-134029672 CCAAGTGCTGCCAGACACAGAGG + Intergenic
938902408 2:135809129-135809151 CCTAGCCATGCCAGGTACATGGG + Exonic
940216394 2:151307858-151307880 GCCAGCCATGCCAGACAGATGGG - Intergenic
941356326 2:164497210-164497232 CAGAGCTCTGCCACAAACATGGG - Exonic
941902394 2:170691003-170691025 GCGAGCCTTGCCAGAATCATAGG + Intergenic
944104023 2:196059923-196059945 CTGCGCCCAGCCAGAAACATAGG - Intronic
944784417 2:203053803-203053825 CAGATACCTGCCAGACACAGTGG - Intronic
946273193 2:218611016-218611038 CCGTGCCCGGCCAGAGACCTTGG + Intronic
948197918 2:236108786-236108808 CCCAGCCCTGCCACACACAGCGG + Intronic
1169077796 20:2772111-2772133 CCTTGCCCTGCCAGACAGATAGG + Intergenic
1169264362 20:4158629-4158651 CTAGGCCCTGGCAGACACATGGG + Intronic
1170476008 20:16715185-16715207 CTCTGCCCTGCCACACACATGGG + Intergenic
1171453831 20:25255389-25255411 CCCAGCCCCTCCAGACACAAAGG - Intronic
1173252575 20:41372318-41372340 CAGAGCCCTGCCACACTCACTGG - Intergenic
1173795115 20:45854497-45854519 CCGCGCCCGGCCTCACACATAGG + Intronic
1174602002 20:51732321-51732343 CCCAGCCCTGCCAGCCCCCTGGG + Intronic
1175273114 20:57748790-57748812 CCCATCCCTGCCAGACAGCTGGG + Intergenic
1179106424 21:38404589-38404611 CCGAGCCCTGAGAGACACATGGG + Intronic
1179887462 21:44320312-44320334 CCGGGACCTGCCAGCCACAGTGG - Intronic
1181028232 22:20137798-20137820 CCCAGCCCTGCCTGGCACACAGG - Intronic
1181169029 22:20998006-20998028 CCGAGCCCTGACATGCACACAGG - Exonic
1182362367 22:29754272-29754294 CCACGCCCTGCCAGAAACACAGG + Intronic
1183064573 22:35354211-35354233 CTGAGCCCTGCAAGCCACTTAGG + Intergenic
1183640388 22:39089075-39089097 CCCATCCCTGCCACCCACATGGG + Intergenic
1184048569 22:41987870-41987892 CCTAGCCCTTCCAGCCAGATGGG + Intronic
1184276719 22:43412934-43412956 CCGGGGCCTGCCAGACTCCTGGG - Intronic
950662721 3:14476707-14476729 CCGAGCCCTGCCAGACACATTGG - Intronic
953127993 3:40110123-40110145 CAAGGCCCTGCCAGACTCATTGG + Intronic
953901553 3:46846607-46846629 CTGGGCCCTGCCAGACACCTGGG - Intergenic
954393678 3:50280881-50280903 CCGCGCCCGGCCAGCCACCTTGG + Intronic
955159495 3:56449899-56449921 CTTAGCCCTGTCAGACACTTTGG + Intronic
961288039 3:125822363-125822385 CCGAGCCCTGGCTGACACTATGG - Intergenic
962267653 3:133955150-133955172 CCGAGCTCTGCCAGAAGCATTGG - Exonic
965901494 3:173645931-173645953 CTGAACCCTGCCACACTCATGGG + Intronic
967234079 3:187367702-187367724 CCGAGCCCTGCCCCACAGAGAGG + Intergenic
967436367 3:189451466-189451488 CCTAGCTCTGTCAGGCACATAGG + Intergenic
969419449 4:7083381-7083403 CCCAGCCCTCTCAGGCACATGGG - Intergenic
969692140 4:8709577-8709599 CCGGACCCTGCCGGACACAAGGG + Intergenic
971911389 4:32800738-32800760 CCCAGTCCTGGCAGACTCATTGG - Intergenic
976587273 4:86812705-86812727 TCGTGCCCTGCCCGCCACATTGG - Intronic
986443529 5:7801278-7801300 CCTCGCCCTGCCAGACACACAGG + Intronic
987099219 5:14577522-14577544 CCCAACCCTGCCCCACACATGGG + Intergenic
987926213 5:24345229-24345251 CCAACCCCTGAGAGACACATGGG - Intergenic
999143763 5:149379490-149379512 CAGAGCCCCACCAGACACACAGG - Intronic
999985887 5:157004995-157005017 CCCAGCCCTGGCAGATACCTTGG - Intergenic
1000260361 5:159582271-159582293 CCCACCCCTGCCAGCCACAATGG + Intergenic
1002518197 5:179774653-179774675 CAGAGCCCTGCCTCACAGATGGG + Exonic
1008535950 6:52506218-52506240 CAGAGCCCAGCCAGGCACAGGGG - Intronic
1009840485 6:69066926-69066948 CCCAGACCTGTCAGACACAAGGG - Intronic
1010889924 6:81294038-81294060 CAGAGCCGTGCCAGACACCTGGG - Intergenic
1018744542 6:166751567-166751589 CCCAGCCGTTCCAGACACCTAGG - Intronic
1023782298 7:43668299-43668321 CTGAGCCCAGCCATCCACATGGG - Intronic
1026896716 7:74013699-74013721 ACTAGCCCTGCCAGACACAAAGG + Intergenic
1026911364 7:74093598-74093620 CCCAGCCCAGCCAGCCACCTGGG + Intronic
1027146987 7:75702529-75702551 CCCAGCCTTGCCAGGCACAGTGG - Intronic
1031070285 7:117154433-117154455 CCTAGCCCTGTCAGCCACACAGG - Intronic
1034845519 7:154440833-154440855 TCCAGCCTTGCCAGCCACATTGG - Intronic
1037757436 8:21720307-21720329 CCCAGCTCTGCCAGTCACAAAGG + Intronic
1038638301 8:29304483-29304505 CCGAGCCCTGCCAGGCAGGAAGG - Intergenic
1047314936 8:123724138-123724160 TTGAGCCCTCCCAGACACCTTGG - Intronic
1049182491 8:141230225-141230247 CCCAGCCCTGACAGCCACAGTGG - Intronic
1049257642 8:141622413-141622435 CGGGGCCCTGCCAGAGACAGAGG - Intergenic
1049806857 8:144545017-144545039 CGGAGCCCTGGCAGACACGAGGG - Intronic
1054898954 9:70347071-70347093 CCAAGACCTTCCAAACACATTGG + Exonic
1058965257 9:110031528-110031550 CAGAGCACTACCTGACACATGGG - Intronic
1058983676 9:110192713-110192735 CCGAGCCCTGGCTGAGAAATAGG - Intronic
1061786378 9:133030988-133031010 GCGGGCCCTGCCAGACGCACAGG + Exonic
1191177225 X:57517062-57517084 CCAAGCCTGGCCACACACATAGG - Intergenic
1199263198 X:145799703-145799725 CACAGCCCTGCCAGACATCTTGG + Intergenic
1200395959 X:155987975-155987997 CAGATCCCTCCCTGACACATGGG - Intergenic
1201256023 Y:12109020-12109042 CCATGCCCTGCCAGACTCACAGG - Intergenic